Explore topic-wise InterviewSolutions in Current Affairs.

Cistron is a segment of DNA coding for a polypeptide. In eukaryotes the transcriptional unit have interrupted coding sequences - exons and introns. It codes for only one polypeptide, so it is called monocistronic. 

In prokaryotes structural genes have many coding sequences, so it is called polycistronic.

Functions of RNA

- It functions as a messenger. 

- It is an adapter. 

- It is a structural component of ribosome 

- It also acts as a catalysts.

A cistron is defined as the length of mRNA, that codes for a polypeptide.

OH group is present on RNA, which is a reactive group so it is unstable and mutate faster.

RNA is an unstable highly reactive molecule due to its single-stranded structure and exposure of its nitrogen bases. But DNA is stable, the molecule, as its, nitrogen bases are not exposed, became its double-helical nature.

a. Contact inhibition is the property of normal cells in which contact with other cells inhibits their uncontrolled growth. Metastasis is the property in which tumour cells reach distant sites in the body, through blood. 

b. Proto oncogenes or Cellular oncogenes. These genes when activated under certain condition could lead to oncogenic transformation of the cells. 

c. Biopsy/radiography/CT/MRI (Any two) 

d. α-interferon activates immune system and destroys the tumour.

The 2' OH-group in the nucleotides of RNA is a reactive group,that makes RNA labile 1 and easily degradable.

A ciston is a segment of DNA, coding for a polypeptide.

DNA   legase. 

1. The lagging template is the template strand with free 5’ end. 

2. The replication always starts at C-3 end of template strand and proceeds towards C-5 end. 

3. Both the strands of the parental DNA are antiparallel and new strands are always formed in 5′ → 3′ direction, i.e. DNA polymerase synthesizes new strand in only one direction i.e. 5′ → 3′ direction. 

4. Hence, the lagging templates becomes available for replication only discontinuously in small patches. 

5. The new lagging strand develops discontinuously away from the replicating fork in the form of small Okazaki fragments. 6. Hence, Okazaki fragments formed on lagging strand only.

Coding strand - 5'

TACGTACGTACGTACGTACGTACG 3'

mRNA stands - 5'

UACGUACGUACGUACGUACGUACG 3'.

The cancerous cells are sloughed from the tumours and reach distant sites through blood, and wherever they get lodged in the body, they start a new tumour there. This property called metastasis is the most feared property of malignant tumours.

DNA polymerase.

Template strand has 3' → 5' polarity.

Meristem culture or shoot tip culture.

Answer is Mule

Corpora quadrigemina consists of 4 solid rounded structures, viz. superior and inferior colliculi. Superior colliculi control visual reflexes while inferior colliculi control auditory reflexes.

(a) It is the practice of mating of animals within the same breed, but having no common ancestors on either side of their pedigree up to 4-6 generations. The offspring of such a mating is known as an out-cross.

(b) In this superior males of one breed are mated with superior females of another breed. Hisardale is a new breed of sheep developed in Punjab by crossing Bikaneri ewes and Marino rams.

Continuous – Inbreeding without selection leads to loss of fertility & productivity.

DNA polymerase helps in the replication of DNA molecules. DNA polymerase also helps in the proofreading, if any error/mutation occurred during replication.

The precursor of mRNA i.e. hnRNA contains both introns and exons. Introns are removed and exons are joined by a process called splicing. The remaining mRNA is processed in two ways : 

(i) Capping : Here, an unusual nucleotide called methyl guanosine triphosphate (cap) is added to the 5' end of hnRNA. 

(ii) Tailing : Here, adenylate residues (200-300) are added at 3' end of hnRNA in a template independent manner. 

When hnRNA is fully processed, it is known as mRNA, which is transported out of the nucleus to get translated.

Prosperities of genetic code:

- AUG is the initiation codon and codes for methionine; methionine is the first amino acid in the given polypeptide. 

- Genetic code is unambiguous and specific, i.e., each codon codes only for on particular amino acid. 

- Genetic code is degenerate, i.e., more than one codon code on one amino acid. 

- Each codon is a triplet, i.e., made of three nucleotides e.g., AUG, UUU, etc. 

- UAG does not code for any amino acid, it is a termination codon.

(c) out breeding

Firstly select animals from inbreed population and mate them with unrelated superior animals of the same breed (Out crossing)). This helps to restore fertility and yield.

Inbreeding depression

1. Inbreeding is the mating of more closely related individuals of the same breed. Continued inbreeding leads to increasing homozygozity and ultimately results in the reduction of fertility and productivity.

2. Purelines.

1. (d), 2. (a), 3. (b), 4. (c)

RNA polymerase – II

hnRNA is the precursor of mRNA that is transcribed by RNA ploymerase II and is called heterogenous nuclear RNA. 

Changes: 

• The hnRNA undergoes two additional processes called capping and tailing. 

• In capping, an unusual nucleotide, methyl guanosine triphosphate, is added to the 5'- end of hnRNA. 

• In tailing, adenylate residues (about 200–300) are added at 3'-end in a template independent manner. 

• Now the hnRNA undergoes a process where the introns are removed and exons are joined to form mRNA by the process called splicing. Fragments on one of the template strands.

a. The molecule ‘X’ is repressor. It gets inactivated when lactose (inducer) binds with the repressor molecule. 

b. z gene codes for β-galactosidase. 

c. Transcription of the gene stops when lactose is absent and thus repressor is free to bind with the operator.

(1) Splicing-the introns are removed and exons are joined together. 

(2) capping -methyl guanosine triphosphate is added to the 5-end of hnRNA.

(3) Tailing- adenylate residues (200-300) are added at 3-end in a template

After these three process, fully processed mRNA is released from nucleus into cytoplasm for protein synthesis.

(b) semi dwarf variety

1. Out crossing

2. Cross breeding

Out crossing

The hnRNA undergoes the following processes to form mRNA: 

i. Capping: Addition of methyl guanosine triphosphate at 5'-end. 

ii. Tailing: Addition of 200-300 adenylate residues at 3'-end. 

iii. Splicing: Removal of introns and rejoining of exons.

For initiation the ribosome binds to the mature,mRNA at the start codon (AUG) that is recognized by , the initiator t-RNA During elongation charged tRNA sequentially binds to the appropriate codon in m-RNA with the anticodon present on tRNA. The ribosome moves from one codon to another adding amino acids one after the other to form polypeptide,i.e. translation. During termination the release factor binds to stop codon (UAA, UAG, UGA), terminating translation and releasing the polypeptide chain.

They are needed for efficient translation

(a) cross breeding

1. Identifies superior male and female of the same breed.

2. Mate them in pairs.

3. Identifies the superior male and female of the progeny for further mating.

4. Select the best breed.

Translation 

▪ Translation is the process of synthesis of protein from mRNA with the help of ribosome. 

▪ A translational unit in mRNA from 5' → 3' comprises of a start codon, region coding for a polypeptide, a stop codon and untranslated regions (UTRs) at both 5'-end and 3'-end for efficient process. 

▪ There are three stages of protein synthesis: 

i. Initiation 

• Assembly of ribosome on mRNA. 

• Activation of amino acids and its delivery to tRNA 

ii. Elongation 

• Repeated cycle of amino acid delivery. 

• Peptide bond formation and movement along the mRNA called translocation. 

iii. Termination 

• The release of a polypeptide chain. 

i. Initiation 

• In prokaryotes, initiation requires the large and small ribosome subunits, the mRNA, initiation tRNA and three initiation factors (IFs). 

• Activation of amino acid: Amino acids become activated by binding with aminoacyl tRNA synthetase enzyme in the presence of ATP. 

• Transfer of amino acid to tRNA: The AA–AMP–Enzyme complex formed reacts with specific tRNA to form aminoacyl-tRNA complex. AA–AMP– Enzyme complex + tRNA → AA–tRNA + AMP + Enzyme. 

• The cap region of mRNA binds to the smaller subunit of ribosome. 

• The ribosome has two sites, A-site and P-site. 

• The smaller subunit first binds to the initiator mRNA and then binds to the larger subunit so that initiation codon (AUG) lies on the P-site. 

• The initiation tRNA, i.e., methionyl tRNA then binds to the P-site. 

ii. Elongation of polypeptide chain 

• Another charged aminoacyl tRNA complex binds to the A-site of the ribosome at the second codon. 

• A peptide bond is formed between carboxyl group (—COOH) of amino acid at P-site and amino group (—NH) of amino acid at A-site by the enzyme peptidyl transferase. 

• The ribosome slides over mRNA from codon to codon in the 5′→3′ direction. 

• According to the sequence of codons, amino acids are attached to one another by peptide bonds and a polypeptide chain is formed. 

iii. Termination of polypeptide 

• When the A-site of ribosome reaches a termination codon which does not code for any amino acid, no charged tRNA binds to the A-site. 

• Dissociation of polypeptide from ribosome takes place, which is catalysed by a ‘release factor’. 

• There are three termination codons namely UGA, UAG and UAA.

Inducer and repressor in lac operon :

Inducer : Lactose is the substrate for the enzyme beta-galactosidase, and it regulates switching on and off of the operon. It is termed as Inducer. 

Repressor : The repressor of the operon is synthesized (all the time constitutively) from the gene. The repressor protein binds to the operator region of the operon and prevents RNA polymerase from transcribing the operon.

Hisardale is a new breed of sheep developed in Punjab by crossing Bikaneri ewes and Marino rams

Repressor protein is produced by the action of gene i (inhibitor). This gene acts as a regulator gene.

(d) Lac Z, Lac Y, Lac A

An operon is a part of DNA that functions as a gene regulatory unit in transcription. 

(a) Regulatory gene : This gene controls the operator gene. This produces a protein substance known as represser which combines with the operator gene to stop its function. 

(b) Operator : It controls the functioning of structural genes which are expressed when operate, gene is turned on by inducer and not expressed when operates is turned off by repressor. 

(c) Promoter : It is the site at which the RNA polymerase binds and reaches the structural genes for the transcription of mRNA to start. 

(d) Structural genes : These genes produce mRNA which synthesize the specific proteins such as enzyme regained for metabolism of Lactose.

Translation 

▪ Translation is the process of synthesis of protein from mRNA with the help of ribosome. 

▪ A translational unit in mRNA from 5' → 3' comprises of a start codon, region coding for a polypeptide, a stop codon and untranslated regions (UTRs) at both 5'-end and 3'-end for efficient process. 

▪ There are three stages of protein synthesis: 

i. Initiation 

• Assembly of ribosome on mRNA. 

• Activation of amino acids and its delivery to tRNA 

ii. Elongation 

• Repeated cycle of amino acid delivery. 

• Peptide bond formation and movement along the mRNA called translocation. 

iii. Termination 

• The release of a polypeptide chain.

(i) Stagnant water bodies, water tanks, flower pots etc. should be searched for checking mosquitoes breeding.

(ii) Malaria, Dengue

(iii) Gambusia, Dragonfly which feeds on mosquito larva and thus eliminates the mosquitoes.

Jersey/Hissardale—a new breed by crossing Bikaneri ewes and Mirano rams (cattle) and Leghorn (poultry).