Explore topic-wise InterviewSolutions in Current Affairs.

A. (iii) 

B. (v) 

C. (ii) 

D. (i) 

E. (iv)

(a) Bengaluru

Limestone is found in sedimentary rocks.

The first hydro-electric power station in India was established at “Darjeeling” in 1897.

Mumbai, Chennai, Kolkata, New Delhi, Pune, Ahmedabad, Lucknow, Satara and Mysore.

Iron and Steel industry: 

1. Age old industry. 

2. Depend upon minerals. 

3. Large scale industry. 

4. Began in 1907.

Software industry: 

1. Recently developed industry. 

2. Depend upon skill and knowledge (technical). 

3. Small and medium scale industry. 

4. Began in 1970

Manganese: 

1. It is a Metallic mineral. 

2. Very hard and brittle in nature. 

3. Raw material for iron and steel basic raw material for alloying.

Mica: 

1. It is a Non-Metallic mineral. 

2. Translucent, splitable into thin sheets, elastic and incompressible. 

3. Exclusively used in electrical goods and also for making lubricants, paints, varnishes etc.

Centres of IT parks in India are located in Chennai, Coimbatore, Thiruvananthapuram, Bengaluru, Mysuru, Hyderabad, Vishakapatnam, Mumbai, Pune, Indore, Gandhinagar, Jaipur, Noida, Mohali and Srinagar.

1. The Nuclear Power Corporation of India Limited ( NPCIL) is wholly owned by the Government of India. 

2. It is a Public sector undertaking. 

3. Responsible for the generation of nuclear power for electricity. 

4. Administered by the Department of Atomic Energy (DAE). It is responsible for designing, constructing and operating the Nuclear power stations in India.

Solar energy: 

1. Conversion of sunlight into electricity. 

2. Photo voltoic cells or use of lenses, mirror and tracking system is used. 

3. Installation cost is more and different applications is required as per the need. 

4. Occupy more space.

Wind energy: 

1. Conversion of energy is from the flow of wind. 

2. Wind turbines are used. 

3. Installation cost is comparatively less. 

4. Occupy less space.

Port located on the riverfront is known as a riverine port. Kolkata is an inland riverine port. It serves the very large Ganga-Brahmaputra basin

(c) CAU GUU UAU CGC

The sequence of template strand will be

3’- 

TACGTACGTACGTACGTACGTACGTACGTAC - 5’ 

Thus, the sequence of mRNA will be

5’- AUGCAAUGCAAUGCAAUGCAAUGCAAUGC

5' - AUGCAUGCAUGCAUGCAUGCAUGCAUG - 3'

a. The sequence of bases in its RNA transcript would be 5' - A U G A A U G - 3'

Correct Answer is: (a) Godavari

We know that the K.E. = p²/2m = K

So, p = √{2mk}

As K.E. is the same, p₂/p₁ = √{m₂/m₁} = √n

(c) direction of water flow

Correct Answer is: (c) Fatehsagar

Correct Answer is: (b) Jaisamand

Rivers of Rajasthan 

(a) Chambal is the only perennial river of Rajasthan. 

(b) Three drainage systems of the state are the Arabian Sea, the Bay of Bengal and the Inland drainage.

(c) The Arabian Sea drainage system includes Luni, Mahi, Sabarmati and West Banas rivers. Luni river originating from Nagapahar (Ajmer), drains into Rann of Kachchh. River Mahi originates from Amoru (MP) district, drains into Bay of Bengal and forms boundary between Dungarpur and Banswara. Tributaries are Son, Amba and Jakham, Mahi Bajaj Sagar Dam on Mahi river.

(d) The Bay of Bengal drainage system includes Chambal, Banas and Banganga rivers which drains into the Yamuna river. Chambal originating from Janapau hills enter Rajasthan, merges with Yamuna and flows through Chittaur, Kota and Sawai Madhopur. On this, are the Gandhi sagar, Ranapratapsagar, Jawaharsagar and Kota Barrage.

River Banas (Van-Ki-Asha) originates near Rumbhalgarh and emerges with Chambal. The Bisalpur dam stands on it. Other rivers are Bedach, Gambhiri, Kothari, Khari, Kalisindh, Parvati, etc.

The Inland drainage system comprises of rivers Kantali, Kakni, Ghaggar, Sabi, Mantha, etc.

Lakes of Rajasthan

(a) Salt water lakes: They include Sambhar, Deedwana, Lunkaransar and Panchbhadra and the others are Falaudi, Kawod, Kachhore and Khosa. The Sambhar is the largest salt water lake in the world. 

(b) Sweet water lakes: They include Jaisamand, Rajsamand, Pichhola, Aanasagar, Pushkar, Silisedh, Udaisagar, Fatchesagar, Nakki, Kailana, etc. 

(c) Freshwater lake : Jaisamand is the world’s second largest lake and largest freshwater lake in the state. 

(d) Silisedh and Kolayat are other lakes of Rajasthan.

Correct Answer is: (d) Parvati

(d) The Kakri river

The Aravalli mountain divides the inland drainage system of Rajasthan into two parts.

Drainage system of the North India: 

1. The Indus river system. 

2. The Ganga river system. 

3. The Brahmaputra system.

The Narmada and the Tapti are the major rivers which drain in the Arabian Sea. The Narmada is the longest river. It originates from Amar Kantak (MP) and flows in rift valley. It presents a beautiful view of the marble rocks of Bhedaghat near Jabalpur. The river Tapti rises in the Betul district of Madhya Pradesh and flows in a trough parallel to the Narmada. The other rivers which drain into the Arabian Sea are Mahi, Sukari, Badi, Sharavati, etc.

Rivers of the Arabian drainage system are the Luni, Mahi, Sabarmati and West Banas. Most important of them are the Mahi and the Luni. The river Luni originates from Nagpahar of Ajmer. It drains into Rann of Kutchchh. The river Mahi originates froms the Amoru district of Madhya Pradesh and drains into Bay of Bengal. It forms boundary between Dungarpur and Banswara. The Mahi Bajaj Sagar Dam has been constructed on it near Banswara. Its tributaries are Son, Amba, Jakham, etc.

Inland drainage system comprises of the rivers which are seasonal and they merge either with small lakes or desert. They are very few in number. There is no surface drainage and there is no flow of water. These types of rivers extend only from Sambhar lake, of Rajasthan to Ghagghar in Haryana. The Mantha, Medha, Khari, Khandela and Rupangarh rivers end in the Sambhar lake of Rajasthan. The Kakari river of Jaisalmer ends in the Bhuj lake of Jaisalmer.

Since the key is taken out due to which there is no magnetic field due to wire. Hence only magnetic field of earth is present and the magnetic field lines of the earth are straight lines parallel to each other.

All rivers of this system join Yamuna river. Among them chief are Chamba, Banas, Ban Ganga, etc. River Chambal originates from Janapav hills near Mahi in Madhya Pradesh. It enters at Chaurasigarh (Chittorgarh) in Rajasthan and joins river Yamuna at Muradganj of Uttar Pradesh, after drainage of Chittor, Kota and Sawai Madhopur, Gandhi Sagar, Rana Pratap Sagar, Jawahar sagar and Kota Barrage are dams built on it.

River Banas originates from Veronka Nath near Kumbhalgarh also called as Van Ki Asha and joins Chambal near Rameshwar in Sawai Madhopur district. The famous Besalpur dam is built on this river. Other rivers are Bedach, Gambhri, Kothani Khari, Kalisindh and Parvati, etc.

Machine Learning

(B) Machine Learning

(P + a/V²)(V - b) = RT

Nitrogen is known to exist as a diatomic molecule. Hence

C_v(for nitrogen) = \(\frac{5R}{2}\) 

= \(\frac{5}{2}\) × 8.3 J mol^-1 K^-1

= 20.75 J mol^-1 K^-1

From Mayer’s relation, C_p = C_v + R

C_p(for nitrogen) = (20.75 + 8.3) J mol^-1 K^-1

= 29.05 K mol^-1 K ^-1

A concave mirror  produces a magnified image when the object is placed in front of the mirror:
(i) between  its pole and focus
(ii) between the focus and centre of curvature
In case (i) the image is virtual and erect, whereas in case (ii) the image is real and inverted.

M = \(\frac{Height\, of\, image}{Height\, of\, object}\)

= \(\frac{h_1}{h_0}\) = \(\frac{-u}{v}\)

Let the height of object be h then height of image h = – 3h

= \(\frac{3h}{h}\) = \(\frac{-v}{u}\) = \(\frac{v}{u}\) = 3

∴ Distance of object, u = – 10 cm

v = 3 × (10) = – 30 cm

Here – sign indicates, image is real and it is 30 cm in front of concave mirror.

Correct option is   C)  \(\frac{R}{n-1}\)

The convex lens behaves as a converging lens, if it is kept in a medium with refractive index less than the refractive index of the lens. It behaves like a diverging lens when it is kept in transparent medium with greater refractive index than that of lens. 

e.g. : Air bubble in water behaves like a diverging lens.

B) Both statements are false

D) between F and P

A) Between the pole of the mirror and its principal focus

The questions asked by Siddhu : 

1. Is the object placed beyond 2f point? 

2. Is the object located at 2f point? 

3. Is the object located in between the 2f and the focal point? 

4. Is the object located at the focal point?

5. Is the object located in front of the focal point? 

6. Is the lens kept in a medium with refractive index less than lens or more than lens?

Correct option is  C) 3/2

A) Between mirror and F

• Spherical mirrors are useful in our daily life in many ways. 
• Convex mirrors are used as rear view mirrors in cars, scooters, buses, etc. This helps us to see the traffic behind the vehicle, which avoids accidents while taking turns.
• Big convex mirrors are used as shop security mirrors. 
• Concave mirrors are used by dentists, opthamologists, to see the smaller parts of teeth, eyes, and ears. 
• Concave mirrors are also used in solar heating devices. 
• Concave mirrors are used as shaving mirrors to see a large image of the chin (or) face. 
• Concave mirrors are used as doctor’s head mirrors to focus light coming from a lamp on to the body parts of the patient to be examined by the doctor. 
• So, I appreciate the role of spherical mirrors in our daily life.

Between focus and centre of curvature.

(c) Trans Siberian