Explore topic-wise InterviewSolutions in Current Affairs.

This section includes 7 InterviewSolutions, each offering curated multiple-choice questions to sharpen your Current Affairs knowledge and support exam preparation. Choose a topic below to get started.

1.

Match the Column I with Column II.Column IColumn IIARajasthan(i)Tidal energyBJharkhand(ii)Wind farmCGujarat(iii)Gypsum DGulf of Kacch(iv)PetroleumEDigboi(v)Coal

Answer»

A. (iii) 

B. (v) 

C. (ii) 

D. (i) 

E. (iv)

2.

The ……. is the largest producer of electronic goods in India. (a) Bengaluru (b) Mysuru (c) Delhi (d) Jaipur

Answer»

(a) Bengaluru

3.

In which type of rocks is limestone found?

Answer»

Limestone is found in sedimentary rocks.

4.

Where was the first hydro-electric power station in India established?

Answer»

The first hydro-electric power station in India was established at “Darjeeling” in 1897.

5.

What are the major centres of the automobile industry?

Answer»

Mumbai, Chennai, Kolkata, New Delhi, Pune, Ahmedabad, Lucknow, Satara and Mysore.

6.

Iron and Steel industry and Software industry.

Answer»

Iron and Steel industry: 

1. Age old industry. 

2. Depend upon minerals. 

3. Large scale industry. 

4. Began in 1907.

Software industry: 

1. Recently developed industry. 

2. Depend upon skill and knowledge (technical). 

3. Small and medium scale industry. 

4. Began in 1970

7.

Difference between Manganese and Mica.

Answer»

Manganese: 

1. It is a Metallic mineral. 

2. Very hard and brittle in nature. 

3. Raw material for iron and steel basic raw material for alloying.

Mica: 

1. It is a Non-Metallic mineral. 

2. Translucent, splitable into thin sheets, elastic and incompressible. 

3. Exclusively used in electrical goods and also for making lubricants, paints, varnishes etc.

8.

Where are the centres of IT parks located in India?

Answer»

Centres of IT parks in India are located in Chennai, Coimbatore, Thiruvananthapuram, Bengaluru, Mysuru, Hyderabad, Vishakapatnam, Mumbai, Pune, Indore, Gandhinagar, Jaipur, Noida, Mohali and Srinagar.

9.

Write a note on NPCIL.

Answer»

1. The Nuclear Power Corporation of India Limited ( NPCIL) is wholly owned by the Government of India. 

2. It is a Public sector undertaking. 

3. Responsible for the generation of nuclear power for electricity. 

4. Administered by the Department of Atomic Energy (DAE). It is responsible for designing, constructing and operating the Nuclear power stations in India.

10.

Distinguish between Solar and Wind energy.

Answer»

Solar energy: 

1. Conversion of sunlight into electricity. 

2. Photo voltoic cells or use of lenses, mirror and tracking system is used. 

3. Installation cost is more and different applications is required as per the need. 

4. Occupy more space.

Wind energy: 

1. Conversion of energy is from the flow of wind. 

2. Wind turbines are used. 

3. Installation cost is comparatively less. 

4. Occupy less space.

11.

How will you define the riverine port?

Answer»

Port located on the riverfront is known as a riverine port. Kolkata is an inland riverine port. It serves the very large Ganga-Brahmaputra basin

12.

The sequence of nitrogen bases in a particulars region of the non-coding stand of a DNA molecule was found to be CAT GTTTAT CGC. What would be the sequence of nitrogen bases in the mRNA that is synthesized the corresponding region of the coding strand in that DNA?(a) GUACAAAUAGCG (b) GTA CAAATA GCC (c) CAU GUU UAU CGC (d) CAAGAATAU GCC

Answer»

(c) CAU GUU UAU CGC

13.

If the sequence of coding strange in a transcription unit is written as follows:5’ATGCATGCATGCATGCATGCATGCATGCATGC3’ Write down the sequence of mRNA.

Answer»

The sequence of template strand will be

3’- 

TACGTACGTACGTACGTACGTACGTACGTAC - 5’ 

Thus, the sequence of mRNA will be

5’- AUGCAAUGCAAUGCAAUGCAAUGCAAUGC

14.

If the sequence of the coding strand in transcription unit is written as follows : 5' - ATGCATGCATGCATGCATGCATGCATGCAT G - 3', Write down the sequence of mRNA.

Answer»

5' - AUGCAUGCAUGCAUGCAUGCAUGCAUG - 3'

15.

If the sequence of nitrogen bases of the coding strand of DNA in a transcription unit is: 5' - A T G A A T G - 3', the sequence of bases in its RNA transcript would be;a. 5' - A U G A A U G - 3'b. 5' - U A C U U A C - 3'c. 5' - C A U U C A U - 3'd. 5' - G U A A G U A - 3'

Answer»

a. The sequence of bases in its RNA transcript would be 5' - A U G A A U G - 3'

16.

The RNA polymerase holoenzyme transcribes:a. the promoter, structural gene and the terminator regionb. the promoter, and thec. the structural gene and the terminator regionsd. the structural gene only.

Answer» c. the structural gene and the terminator regions
17.

It is the largest river of Peninsular Plateau: (a) Godavari (b) Krishna (c) Mahanadi (d) Kaveri

Answer»

Correct Answer is: (a) Godavari

18.

Two masses one n times heavier than the other have equal kinetic energies. How do their momenta compare?

Answer»

We know that the K.E. = p2/2m = K

So, p = √{2mk}

As K.E. is the same, p2/p1 = √{m2/m1} = √n

19.

The effect of inclination of Peninsular Plateau is seen on (a) structure (b) water mass (c) direction of water flow (d) quantity of soil

Answer»

(c) direction of water flow

20.

Which of the following is one of the fresh water lakes of Rajasthan? (a) Didwana (b) Sambhar (c) Fatehsagar (d) Lunkarnsar

Answer»

Correct Answer is: (c) Fatehsagar

21.

The largest fresh water lake of Rajasthan is (a) Rajsamand (b) Jaisamand (c) Sambhar (d) Pushkar

Answer»

Correct Answer is: (b) Jaisamand

22.

What do you know about the rivers and lakes of Rajasthan?

Answer»

Rivers of Rajasthan 

(a) Chambal is the only perennial river of Rajasthan. 

(b) Three drainage systems of the state are the Arabian Sea, the Bay of Bengal and the Inland drainage.

(c) The Arabian Sea drainage system includes Luni, Mahi, Sabarmati and West Banas rivers. Luni river originating from Nagapahar (Ajmer), drains into Rann of Kachchh. River Mahi originates from Amoru (MP) district, drains into Bay of Bengal and forms boundary between Dungarpur and Banswara. Tributaries are Son, Amba and Jakham, Mahi Bajaj Sagar Dam on Mahi river.

(d) The Bay of Bengal drainage system includes Chambal, Banas and Banganga rivers which drains into the Yamuna river. Chambal originating from Janapau hills enter Rajasthan, merges with Yamuna and flows through Chittaur, Kota and Sawai Madhopur. On this, are the Gandhi sagar, Ranapratapsagar, Jawaharsagar and Kota Barrage.

River Banas (Van-Ki-Asha) originates near Rumbhalgarh and emerges with Chambal. The Bisalpur dam stands on it. Other rivers are Bedach, Gambhiri, Kothari, Khari, Kalisindh, Parvati, etc.

The Inland drainage system comprises of rivers Kantali, Kakni, Ghaggar, Sabi, Mantha, etc.

Lakes of Rajasthan

(a) Salt water lakes: They include Sambhar, Deedwana, Lunkaransar and Panchbhadra and the others are Falaudi, Kawod, Kachhore and Khosa. The Sambhar is the largest salt water lake in the world. 

(b) Sweet water lakes: They include Jaisamand, Rajsamand, Pichhola, Aanasagar, Pushkar, Silisedh, Udaisagar, Fatchesagar, Nakki, Kailana, etc. 

(c) Freshwater lake : Jaisamand is the world’s second largest lake and largest freshwater lake in the state. 

(d) Silisedh and Kolayat are other lakes of Rajasthan.

23.

Which of the followig river is not a part of Inland Drainage? (a) Mantha (b) Medha (c) Kakni (d) Parvati

Answer»

Correct Answer is: (d) Parvati

24.

Which river is not included in the Arabian Sea drainage system: (a) The Luni river (b) The Mahi river (c) The West Banas river (d) The Kakri river

Answer»

(d) The Kakri river

25.

Which mountain divides the inland drainage system of Rajasthan into two parts?

Answer»

The Aravalli mountain divides the inland drainage system of Rajasthan into two parts.

26.

Divide the drainage system of the North India.

Answer»

Drainage system of the North India: 

1. The Indus river system. 

2. The Ganga river system. 

3. The Brahmaputra system.

27.

Write about the Arabian Sea rivers system.

Answer»

The Narmada and the Tapti are the major rivers which drain in the Arabian Sea. The Narmada is the longest river. It originates from Amar Kantak (MP) and flows in rift valley. It presents a beautiful view of the marble rocks of Bhedaghat near Jabalpur. The river Tapti rises in the Betul district of Madhya Pradesh and flows in a trough parallel to the Narmada. The other rivers which drain into the Arabian Sea are Mahi, Sukari, Badi, Sharavati, etc.

28.

Mention about the rivers of the Arabian Sea drainage system.

Answer»

Rivers of the Arabian drainage system are the Luni, Mahi, Sabarmati and West Banas. Most important of them are the Mahi and the Luni. The river Luni originates from Nagpahar of Ajmer. It drains into Rann of Kutchchh. The river Mahi originates froms the Amoru district of Madhya Pradesh and drains into Bay of Bengal. It forms boundary between Dungarpur and Banswara. The Mahi Bajaj Sagar Dam has been constructed on it near Banswara. Its tributaries are Son, Amba, Jakham, etc.

29.

Write about the Inland drainage system of India.

Answer»

Inland drainage system comprises of the rivers which are seasonal and they merge either with small lakes or desert. They are very few in number. There is no surface drainage and there is no flow of water. These types of rivers extend only from Sambhar lake, of Rajasthan to Ghagghar in Haryana. The Mantha, Medha, Khari, Khandela and Rupangarh rivers end in the Sambhar lake of Rajasthan. The Kakari river of Jaisalmer ends in the Bhuj lake of Jaisalmer.

30.

If the key in the arrangement as shown below is taken out (the circuit is made open) and magnetic field lines are drawn over the horizontal plane ABCD, the lines areA. Concentric circles B. elliptical in shape C. Straight lines parallel to each other D. Concentric circles near the point O but of elliptical shapes as we go away from it

Answer»

Since the key is taken out due to which there is no magnetic field due to wire. Hence only magnetic field of earth is present and the magnetic field lines of the earth are straight lines parallel to each other.

31.

Explain the Bay of Bengal drainage system of Rajasthan.

Answer»

All rivers of this system join Yamuna river. Among them chief are Chamba, Banas, Ban Ganga, etc. River Chambal originates from Janapav hills near Mahi in Madhya Pradesh. It enters at Chaurasigarh (Chittorgarh) in Rajasthan and joins river Yamuna at Muradganj of Uttar Pradesh, after drainage of Chittor, Kota and Sawai Madhopur, Gandhi Sagar, Rana Pratap Sagar, Jawahar sagar and Kota Barrage are dams built on it.

River Banas originates from Veronka Nath near Kumbhalgarh also called as Van Ki Asha and joins Chambal near Rameshwar in Sawai Madhopur district. The famous Besalpur dam is built on this river. Other rivers are Bedach, Gambhri, Kothani Khari, Kalisindh and Parvati, etc.

32.

______________ is the scientific study of algorithms and statistical models that computer systems use to effectively perform a specific task.

Answer»

Machine Learning

33.

______________ is the scientific study of algorithms and statistical models that computer systems use to effectively perform a specific task. (A) Artificial Intelligence (B) Machine Learning (C) Big Data (D) Blockchain

Answer»

(B) Machine Learning

34.

Write the Vander Waals equation for one mole of a real gas.

Answer»

(P + a/V2)(V - b) = RT

35.

State a difference between the wires used in the element of an electric heater and in a fuse.

Answer» The melting point of the wire used in heater elements is high while a fuse wire has low melting point.
36.

Find the value of Cv and Cp for nitrogen. (Given R = 8.3 J mol-1 K-1 ; also, for a diatomic gas, Cv = \(\frac{5}{2}\) R.

Answer»

Nitrogen is known to exist as a diatomic molecule. Hence

Cv(for nitrogen) = \(\frac{5R}{2}\) 

= \(\frac{5}{2}\) × 8.3 J mol-1 K-1

= 20.75 J mol-1 K-1

From Mayer’s relation, Cp = Cv + R

Cp(for nitrogen) = (20.75 + 8.3) J mol-1 K-1

= 29.05 K mol-1 K -1

37.

State two positions in which a concave mirror produces a magnified image of a given object. List two differences between the two images.

Answer»

A concave mirror  produces a magnified image when the object is placed in front of the mirror:
(i) between  its pole and focus
(ii) between the focus and 
centre of curvature
In case (i) the image is virtual and erect, whereas in case (ii) the image is real and inverted.

38.

A concave mirror produces three times magnified (enlarged) real image of an object placed at 10 cm in front of it. Where is the image located?

Answer»

M = \(\frac{Height\, of\, image}{Height\, of\, object}\)

\(\frac{h_1}{h_0}\) = \(\frac{-u}{v}\)

Let the height of object be h then height of image h = – 3h

\(\frac{3h}{h}\) = \(\frac{-v}{u}\) = \(\frac{v}{u}\) = 3

∴ Distance of object, u = – 10 cm

v = 3 × (10) = – 30 cm

Here – sign indicates, image is real and it is 30 cm in front of concave mirror.

39.

Focal length of the piano – convex lens is ………………… when its radius of curvature is R and n is refractive index of the lens. A)  \(\frac{-R}{n-1}\)B)  \(\frac{n-1}{R}\)C)  \(\frac{R}{n-1}\)D)  \(\frac{n-1}{-R}\)

Answer»

Correct option is   C)  \(\frac{R}{n-1}\)

40.

Explain how a convex lens behaves on converging lens and diverging lens

Answer»

The convex lens behaves as a converging lens, if it is kept in a medium with refractive index less than the refractive index of the lens. It behaves like a diverging lens when it is kept in transparent medium with greater refractive index than that of lens. 

e.g. : Air bubble in water behaves like a diverging lens.

41.

Statement X: The Convex lens behaves as a converging lens if it is kept in a medium with refractive index less than the refractive index of the lens. Statement Y: The convex lens behaves as a diverging lens if it is kept in a medium with refractive index more than the refractive index of the lens. A) Both statements are true B) Both statements are false C) X is true, Y is false D) X is false, Y is true

Answer»

B) Both statements are false

42.

Where should we keep the object to get a large, virtual image with concave mirror ? A) at ‘F’ B) at ‘C’ C) beyond ‘C’ D) between F and P

Answer»

D) between F and P

43.

The image formed by a concave mirror is observed to be virtual, erect and larger than the object. Where should be the position of the object ? A) Between the pole of the mirror and its principal focus B) Beyond the centre of curvature C) At the centre of curvature D) Between the principal focus and the centre of curvatureer than the 

Answer»

A) Between the pole of the mirror and its principal focus

44.

Harsha tells Siddhu that the double convex lens always behaves like a convergent lens. But Siddhu knows that Harsha’s assertion is wrong and corrected Harsha by asking some questions. What are the questions asked by Siddhu?

Answer»

The questions asked by Siddhu : 

1. Is the object placed beyond 2f point? 

2. Is the object located at 2f point? 

3. Is the object located in between the 2f and the focal point? 

4. Is the object located at the focal point?

5. Is the object located in front of the focal point? 

6. Is the lens kept in a medium with refractive index less than lens or more than lens?

45.

The refractive index of the glass which is symmetrical convergent lens if its focal length is equal to the radius of curvature of its surface ……………….. A) 1 B) 2/3C) 3/2D) -3/2

Answer»

Correct option is  C) 3/2

46.

Where is the object placed to get a virtual image in front of concave mirror? A) Between mirror and F B) On focal point C) Between F and C D) On C

Answer»

A) Between mirror and F

47.

How do you appreciate the role of spherical mirrors in our daily life? (OR) Write the usage of spherical mirror in daily life situations.

Answer»
  • Spherical mirrors are useful in our daily life in many ways. 
  • Convex mirrors are used as rear view mirrors in cars, scooters, buses, etc. This helps us to see the traffic behind the vehicle, which avoids accidents while taking turns.
  • Big convex mirrors are used as shop security mirrors. 
  • Concave mirrors are used by dentists, opthamologists, to see the smaller parts of teeth, eyes, and ears. 
  • Concave mirrors are also used in solar heating devices. 
  • Concave mirrors are used as shaving mirrors to see a large image of the chin (or) face. 
  • Concave mirrors are used as doctor’s head mirrors to focus light coming from a lamp on to the body parts of the patient to be examined by the doctor. 
  • So, I appreciate the role of spherical mirrors in our daily life.
48.

Where should an object be placed in front of the concave mirror so as to obtain its virtual, erect and magnified image ?

Answer» Between pole and focus.
49.

For which positions of the object does a concave mirror produce an inverted, magnified and real image ?

Answer»

Between focus and centre of curvature.

50.

Which of the following is the longest railways of the world? (a) Canadian Pacific (b) Northern Transcontinental (c) Trans Siberian (d) Cape Cairo

Answer»

(c) Trans Siberian