Saved Bookmarks
This section includes 7 InterviewSolutions, each offering curated multiple-choice questions to sharpen your Current Affairs knowledge and support exam preparation. Choose a topic below to get started.
| 1. |
The optical density of turpentine is higher than that of water while its mass density is lower. Figure shows a layer of turpentine floating over water in a container. For which one of the four rays incident on turpentine in figure the path shown is correct? [NCERT Exemplar] (a) 1 (b) 2 (c) 3 (d) 4 |
| Answer» INCIDENT on Turpentine....for BETTER answers PLEASE follow me...please MARK as brainliest | |
| 2. |
Prove whether kinetic energy is scalar or vector |
| Answer» ENERGY is a SCALAR QUANTITY because it doesn't have dirrection | |
| 3. |
Please do this answer |
|
Answer» according to law of REFLECTION the angle of incidence is equals to the angle of reflection so 30 =30 |
|
| 4. |
◆No spam ...give all answers...or U know what I will do... |
|
Answer» what have do you WANT from me E you ASKING me again and again |
|
| 5. |
This answer I will surely make him her brainliest |
|
Answer» not CLEAR photoExplanation: |
|
| 6. |
Length a rectangular field is 55 m and breadth is 30 m find the area |
|
Answer» 1650Explanation:55*30 |
|
| 7. |
Charectesstiesa photon |
|
Answer» They have zero mass and REST energy. ...They are ELEMENTARY particles despite LACKING rest mass.They have no electric charge.They are stable.They are spin-1 particles which MAKES them bosons.They carry energy and momentum which are dependent on the FREQUENCY. |
|
| 8. |
A car is moving with 40 m/s velocity on straight highway. A student which is in the car noted each kilometre distance and the time taken by the car. The graph between distance and time for the motion is [1] (1) (2) (3)p |
| Answer» TION:so we can FIND SPEED and ACCELERATION but can you TELL what we have to find in it | |
| 9. |
SYMBOL AND UNITS OF DERIVED QUANITITIES |
|
Answer» Here is your answerQuantities. Symbol. Units. 1. Mass. m. kg. 2. Force. f. N (NEWTON). 3. Pressure. p. pa (Pascal). 4. Temperature. °(degree). K (Kelvin). 5. Time. t. sec (second). 6. Velocity. U(initial) & v(final). m/s 7. Acceleration. a. m/S2. 8. Distance. S. m. 9. Work. w. j (JOULE). 10. Electric charge. c. c (coloumb) Here are 10. If you want more symbols and units just comment me down. |
|
| 10. |
A 6 volt battery of internal resistance 0.5 is connected to three resistors of value, 3ohm, 4ohm,and 5ohm. Calculate the current in each resistor, and the 4 and 5 ohm resistors are in parallel |
|
Answer» The total resistance of a circuit connected to the given cell of emf 15 V is the sum of all the resistances from VARIOUS sources like, resistors, ammeter, voltmeter, etc., connected in series along with the internal resistance of the cell. In this case, the total resistance is given as 3Ω+3Ω+6Ω=12ohms. From the ohm's law the total current can be calculated from the formula I=V/R. That is, I= R V = 12A 15V =1.25A. Hence, the current through the BATTERY is 1.25 amperes. The VOLTAGE output of a device is measured across its terminals and is called its terminal voltage V. Terminal voltage is given by the equation V=emf−Ir where, r is the internal resistance and I is the current flowing at the TIME of the measurement. Therefore, V=15V−(1.25×3)=11.25V. Hence, the potential difference across the terminals of the cell is 11.25V |
|
| 11. |
An object is immersed in a fluid. In order that the object becomes invisible, it should (a) behave as a perfect reflector. (b) absorb all light falling on it. (c) have refractive index one. (d) have refractive index exactly matching with that of the surrounding fluid. |
|
Answer» Option DExplanation:If the refractive index of the body becomes equal to SURROUNDING liquid, there will not be any deviation in the direction of LIGHT neither will any light get reflected from its surface. So, the OBJECT becomes invisible.Please MARK it as BRAINLIEST |
|
| 12. |
An under-water swimmer cannot see very clearly even in absolutely clear water because of (a) absorption of light in water (b) scattering of light in water (c) reduction of speed of light in water (d) change in the focal length of eye lens |
|
Answer» b. scattering of LIGHT in waterExplanation:DUE to irregular reflection of light sight in WATER appears blurred |
|
| 13. |
Which of the following colours of white light deviated most when passes through a prism? (a) Red light (b) Violet light (c) Yellow light (d) Both (a) and (b) |
| Answer» | |
| 14. |
Which of the following forms a virtual and erect image for all positions of the object? (a) Concave lens (b) Concave mirror (d) Convex mirror (d) Both (a) and (c) |
| Answer» TION:I THINK CONVEX mirror is right answer | |
| 15. |
The centre of mass of any object having uniform density is at its centroid |
|
Answer» tion:simple RIGID objects with uniform density, the center of mass is LOCATED at the CENTROID |
|
| 16. |
Two lenses of focal lengths 20 cm and – 40 cm are held in contact. The image of an object at infinity will be formed by the combination at (a) 10 cm (b) 20 cm (c) 40 cm (d) infinity |
|
Answer» The image is formed at the focus, f = 10 cmExplanation:f1 = f2 = 10 cmFocal length of lenses in COMBINATION : 1 /f = 1/f1 + 1 /f21 /f = 1 /20 + 1 /20 = 2 /20f = 10 cmu = infinityLens formulae : 1/f = 1 /v - 1 /u1 /v = 1 /f + 1/u ( 1/∞ = 0 ) = 1 /10 + 0 = 1 /10V = 10 CM |
|
| 17. |
A convex lens is dipped in a liquid whose refractive index is equal to the refractive index of the lens. Then its focal length will (a) become zero (b) become infinite (c) become small, but non-zero (d) remain unchanged |
|
Answer» the FOCAL LENGTH of convex lens 1/f=(u2/u1-1) (1/R1-1/R2)Here u1=u2the focal length =0it will act as PLANE sheet.hope so helpfulnice QUESTION ....., |
|
| 18. |
Mirage is a phenomenon due to (a) refraction of light (b) reflection of light (c) total internal reflection of light (d) diffraction of light. |
|
Answer» (c) TOTAL INTERNAL REFLECTION of lightpls PLS mark me down as a brainiest answer!!!! |
|
| 19. |
A rod of length 10 cm lies along the principal axis of a concave mirror of focal length 10 ’em in such a way that its end closer to the pole is 20 cm away from the mirror. The length of the image is (a) 10 cm (b) 15 cm (c) 2.5 cm (d) 5 cm |
| Answer» | |
| 20. |
An astronomical refractive telescope has an objective of focal length 20 m and an eyepiece of focal length 2 cm. Then (a) the magnification is 1000 (b) the length of the telescope tube is 20.02 m (c) the image formed of inverted (d) all of these |
| Answer» CATION is 1000.for better answers PLEASE follow me and MARK as BRAINLIEST | |
| 21. |
Two beams of red and violet color are made to pass separately through a prism (angle of the prism is 60°). In the position of minimum deviation, the angle of refraction will be (a) 30° for both the colors (b) greater for the violet color (c) greater for the red color (d) equal but not 30° for both the colors |
|
Answer» the MINIMUM deviation=A(u-1)here deviation will is DIRECTLY promotional to REFRACTIVE index of light. here the the deviation is more in violet colour then in RED HOPE so helpful good question keep it up! |
|
| 22. |
For a total internal reflection, which of the following is correct? (a) Light travels from rarer to denser medium. (b) Light travels from denser to rarer medium. (c) Light travels in air only. (d) Light travels in water only. |
|
Answer» the condition for internal reflection is that light should travelle from DENSER to rare then only the light will MOVE AWAY from NORMAL and there will be chances of internal reflection. HOPE so helpful.keep it up!!good question. |
|
| 23. |
Physics is a branch of science that tells about the laws of _ |
| Answer» QUANTUM mechanicsExplanation: | |
| 24. |
how will you distinguish between a plane mirror, a convex mirror and a concave mirror without touching them ? |
|
Answer» touching any mirror you can distinguish between it by keeping a PENCIL or any object over them.If the image formed as same size to the object then the mirror is plane mirror.If the image is large in size then the mirror is concave and if the image formed is SMALLER in size then the mirror is convex.HOPE YOU FIND IT HELPFUL.. |
|
| 25. |
A body moves 3km due west and then 4km due north . The displacement of the body is |
| Answer» | |
| 27. |
Plzzzz solve them faaast |
| Answer» N1)question1)|A|=3 ,|B|=4,|c|=6a) find max. value and minimum values of |a+b-c|solution:-Here ,it's very IMPORTANT to, understand,that,mod only shows the MAGNITUDE,....if |A|=3....then it means,that the magnitude of that vector is eqaul to 3.Whether it is positive or negative is not fixed..If we take,VectorA and VectorB as negativethen|A+B-C|=|-3-4-6|=13this will be the maximum value,coz,it is the sum of all three......now, let's think on minimum valueIf vectorA and Vector B will be taken as positivethen|A+B-C|=|3+4-6|=1|A+B-C|=|3+4-6|=1This will be the minimum value....b)If vectorA ,vectorB,vectorC are mutually perpendicular,then find|A+B-2C|Solution:-If the three vectors(X,y,z) are perpendicular then the sum of their magnitude=(x^2+y^2+z^2)^1/2herex=A=3y=B=4,z=-2c=-2×6=12(-)magnitude=(9+16+14)^1/2=(169)^1/2=13c)can(|A+2B+C|=0?solution:-minimum value which can be possible|A+2B+C|=|-3+4×2-6|=1 minimum value will be1 minimum value will be1 HENCE 0 can't be possible | |
| 28. |
Name and explain a fibre which appears to resemble wool. |
|
Answer» AcrylicExplanation:ACRYLIC is an ARTIFICIAL FIBRE that resembles wool. It is cheaper than the natural wool and easily available in VARIOUS DYED colours. |
|
| 29. |
Pls ans .fast .........xd |
|
Answer» Answer of 15The Boltzmann CONSTANT has the DIMENSION energy divided by TEMPERATURE, the same as ENTROPY. as we know that pV=nRT. where N is the number of molecules of gas. For n = 1 mol, N is equal to the number of particles in one mole (Avogadro's number).Please mark me as brainliest |
|
| 30. |
Pls ans .fast ........xd |
|
Answer» Answer of 7Physical quantities that has same DIMENSIONAL formula are:Work and Torque [ML^2T^-2]Stress and Pressure [ML^-1T^-2]Surface tension and Surface energy [ML^0T^-2]VELOCITY GRADIENT and Frequency [M^0L^0T^-1]Refractive index and STRAIN [M^0L^0T^0]please mark me as brainliest |
|
| 31. |
Name the instrument use to measure the mass |
|
Answer» the answer is Balance.... HOPE it HELP U.... If the answer is correct than MARK AS BRAINLIEST.... |
|
| 32. |
How does heat transfer in water or air |
|
Answer» Heat transfer in WATER or air TAKES PLACE DUE to CONVECTION. |
|
| 33. |
A car covers first 50 km at the speed of 45 km/h and the next 50 km at the speed of 90 km/h. Find the average speed of the car in km/h. |
|
Answer» -A car covers first 50KM at the speed of 45kmph and the next 50km at the speed of 90kmph.To Find :-Average speed of car during whole journey.Concept :-Average speed of body is defined as RATIO of TOTAL DISTANCE covered to the total time taken.Calculation :-If body covers first HALF of total distance with velocity V1 and secobd half of total distance with velocity V2, then average velocity of body is given by |
|
| 34. |
The resultant of two equal forces is 141.4N when they are mutually perpendicular. When they are inclined at an angle 60 then the resultant force will be |
|
Answer» this ATTACHMENT |
|
| 35. |
The average speed of a person to school is 30km/h .on the return trip along the same route the average speed is 25km/h .find the average speed for the entire tril |
|
Answer» Average velocity of the person is 27.5 km/h.Explanation:Average SPEED is given by the FORMULAE :AVG speed = = 30 + 25 /2 = 27.5 km/h |
|
| 36. |
If the angle between two vectors of equal magnitude is p is X thern magnitude of difference of the two vectors is |
| Answer» | |
| 37. |
When a metallic conductor is heated the atoms will vibrate with greater amplitude and frequency? |
| Answer» PROPERTY of ATOM TH | |
| 38. |
A diver at a depth 12 m inside water (p = 4/3) sees the sky in a cone of semi-vertical angle |
|
Answer» sin^-1(3/4) ...................... |
|
| 39. |
In the formation of a rainbow, the light from the sun on water droplets undergoes (a) dispersion only. (b) only TIR. (c) dispersion and TIR. (d) scattering. |
|
Answer» ion...Rainbow forms due to DISPERSION of sunlight.for BETTER ANSWERS please follow me.please mark as BRAINLIEST |
|
| 40. |
The motion which repeats itself after fixed interval of time is called Rest and motion areIf the position of an object does not change with time and surroundings it is said to be in the state ofPhysics is a branch of science that tells about the laws of |
|
Answer» the motion repeat itself it is pendulamotion if position of an OBJECT are straight LINE motion PLS MARK me a brainlist answer |
|
| 41. |
Tom’ lenses of focal lengths ± 15 cm and ± 150 cm are available for making a telescope. To produce the largest magnification, the focal length of the eyepiece should be (a) + 15 cm (b) + 150 cm (c) – 150 cm (d) – 15 cm |
| Answer» B) +150CM................✔ | |
| 42. |
ics Multiple choice Questions and Answers pdf Question 6. The length of an astronomical telescope for normal vision (relaxed eye) will be |
|
Answer» fo+fe ......................................... |
|
| 43. |
The astronomical telescope consists of objective and eyepiece. The focal length of the objective is (a) equal to that of the eyepiece. (b) shorter than that of eyepiece. (c) greater than that of eyepiece. (d) five times shorter than that of eyepiece. |
|
Answer» ronomical telescope CONSISTS of OBJECTIVE and eyepiece. The focal length of the objective is c) greater than that of an eyepiece.The objective and EYE piece in an astronomical telescope are described with a RELATIONSHIP as fo >fe.The magnifying power of the telescope is fo/fe. This power becomes large when fo >fe. THUS, the focal length of the objective is greater than the eyepiece. |
|
| 44. |
A convex lens of refractive index \frac{3}{2} has a power of 2.5 D in air. If it is placed in a liquid of refractive index 2 then the new power of the lens is (a) – 1.25 D (b) – 1.5 D (c) 1.25 D (d) 1.5 D |
|
Answer» (d) 1.5 DEXPLANATION:STEP by step EXPLANATION |
|
| 45. |
Optics class 12 Questions and Answers pdf 11. A convex lens and a concave lens, each having the same focal length of 25 cm, are put in contact to form a combination of lenses. The power of the combination (in dioptres) is (a) zero (b) 25 (c) 50 (d) infinity |
|
Answer» Power of the combination = 0 D.Explanation:f1 = 25 CM (CONVEX lens)f2 = - 25 cm (Concave lens)Focal LENGTH of LENSES in combination :1/f = 1/25 - 1/25 = 0/25 = 0Power = 1 / focal lengthP = 1 /f = 0 D |
|
| 46. |
A metal coin is at bottom of a beaker filled with a liquid of refractive index = 4/3 to height of 6 cm. To an observer looking from above the surface of liquid, coin will appear at a depth (a) 1.5 cm (b) 6.75 cm (c) 4.5 cm (d) 7.5 cm |
|
Answer» the APPARENT distance=d^=d(u2/u1) d^=6(3/4)here u1=water refractive INDEX u2 =AIR refractive indexd^=9/2=4.5cmhope so helpfulgood QUESTION keep it up! |
|
| 47. |
Optics MCQ Question 7. The focal length of a biconvex lens of radii of each surface 50 cm and refractive index 1.5, is (a) 40.4 cm (b) 75 cm (c) 50 cm (d) 80 cm |
|
Answer» cixttx8txtxtxiyxoyx8txyc8yv8f8888fff555dttt8888xxxxxxxxxxx9zzz9zzz9zzz9yyy9yyy9zzz0zzz0zzzzzxxxyxxx0hhh0xxx0zzz0zzz0xxx0zzzyyyyyzzz0zzzyzzz0zzz0uuuuudExplanation:yyyd888sssstxiixiyxohciy7ex 5d888fffciccccigggx8888 |
|
| 48. |
When a ray of light enters from one medium to another, then which of the following does not change? (a) Frequency (b) Wavelength (c) Speed (d) Amplitude |
| Answer» FREQUENCY doesn't chabge | |
| 49. |
The refractive index of the material of an equilateral prism is √3. What is the angle of minimum deviation? (a) 45° (b) 60° (c) 37° (d) 30° |
| Answer» TION:each eptdl7tdp7hcpihdpincolncljnvn N kibdougo6rso6rsprs0rdp77d7tspprsp7tdtsordp7d075d777fttttcccfcccguuugofogcccucccccgcccccucccccucucccgiiccciiiii | |
| 50. |
On ray optics class 12 pdf 5. We combine two lenses, one is convex and other is concave having focal lengths /, and f2 and their combined focal length is F. Combination of the lenses will behave like concave lens, if (a) f1 > f2 (b) f1 = f2 (c) f1 < f2. (d) f1 ≤ f2 |
|
Answer» has BRAINLIEST PLEASE... |
|