Explore topic-wise InterviewSolutions in Current Affairs.

This section includes 7 InterviewSolutions, each offering curated multiple-choice questions to sharpen your Current Affairs knowledge and support exam preparation. Choose a topic below to get started.

1.

Deep sea sponges have silicate spicules because: (a) precipitation of calcium carbonate is hindered by the depth. (b) at greater depth sequestration of silica is easier. (c) only silicious spicules make circulation of water through body efficient. (d) availability of calcium is relatively less at depth.

Answer»

(b) at greater depth sequestration of silica is easier.

2.

A pure tall pea plant (Pisum sativum) with axillary pods is crossed with dwarf pea plant with terminal pods. Out of 48 F2 generation plants, how many will have phenotype like parents? (a) 18 (b) 27 (c) 30 (d) 20

Answer»

Correct answer is (c) 30

3.

Which process of cell ingestion is shown in diagram below?(a) Exocytosis (b) Pinocytosis (c) Phagocytosis (d) Macrophage engulfing an infectious agent

Answer»

(c) Phagocytosis

4.

The sugar glider and flying squirrel belong to two different groups of mammals, but they have both evolved bushy tails and flaps of skin that help them exploit their forest environments more efficiently. This pattern of evolution is an example of: (a) character displacement (b) adaptive radiation. (c) convergent evolution (d) divergent evolution

Answer»

(c) convergent evolution

5.

Consider four different striated muscles M1, M2, M3 and M4 of varying lengths L1, L2, L3 and L4. All these muscles have fibers running parallel to their longitudinal axis. Muscles M1, M2 and M4 have similar area of cross section while M3 has double than others. if L2= L3, 2*L3 = L4 and L1 =1/4 L2, the maximum force produced by a muscle will be greater in : (a) M1 (b) M2 (c) M3 (d) M4

Answer»

Correct answer is (c) M3

6.

The gas transfer system found in Aves is represented in following figures: (Bold arrows represent blood flow while thin arrows represent air flow through respiratory stem.) The correct representation is in the figure:

Answer»

Correct answer is (b)

7.

Which of following characters are found in prokaryotes? (i) presence of DNA (ii) presence of flagella (iii) presence of cytoskeleton (iv) presence of cell wall (v) presence of pili (a) i, ii, iii, iv and v (b) only i, iii, and v (c) only ii, iii and iv (d) only i. ii, iv and v

Answer»

(a) i, ii, iii, iv and v 

8.

Two ecological pyramids (I and II) are shown. Mark the correct statement that describes them.(a) I is a biomass pyramid while II is a number pyramid. (b) I is likely to represent rain forest while II represents desert ecosystem. (c) I is biomass pyramid of a grassland and II is number pyramid of oceanic ecosystem. (d) I is an energy pyramid of rain forest and Ii is biomass pyramid of host and parasite. 

Answer»

(a) I is a biomass pyramid while II is a number pyramid.

9.

Mark the correct option that shows highest to lowest % resorption of substances from nephron: (a) Water > Sodium > Urea (b) Glucose > Water > Urea (c) Water > Urea > Glucose (d) Urea > Glucose > Sodium

Answer»

(b) Glucose > Water > Urea

10.

In the following diagram distribution of 4 species of plants (P, Q, Rand S) along length of a geographical unit has been depicted. Which among them would best represent vegetation across a cliff?

Answer»

Correct answer is (c)

11.

Observe the given diagram and select the possible reason for the movement of water through the Semipermeable membrane (SM) separating sides A and B:(a) Addition of solute reduces the water potential in side A hence water moves from A to B: (b) Withdrawal of piston in side, B increases water potential hence water move from A to B. (c) Due to atmospheric pressure in side A, water potential becomes 0 and hence water moves from A to B. (d) Withdrawal of piston in side B decreases the water potential and hence water moves from A to B.

Answer»

(d) Withdrawal of piston in side B decreases the water potential and hence water moves from A to B.

12.

The diagram below shows the concentration of hormones in circulating blood as percentage of their maximum possible concentration. Which phase of ovarian cycle of a mammal does it represent?

Answer»

(c) Gibberellic acid

13.

In a population of a species with 500 gene loci, half the loci are fixed.In the remaining, there are two alleles at each locus. How many alleles are therein the gene pool? (a) 500 (b) 750 (c) 250 (d) 550

Answer»

Correct answer is (b) 750

14.

The photosynthetic pigment that provides effective photoprotection is : (a) chlorophyll b (b) chlorophyll e (c) phycobilins (d) carotenoids

Answer»

(d) carotenoids

15.

If a quantitative character is influenced by an additive effect of four genes, how many phenotypic categories are expected in the progeny of a tetrahybrid cross? (a) 5 (b) 7 (c) 9 (d) 11

Answer»

Correct answer is (c) 9

16.

Though both starch and cellulose are composed of repeating glucose units, the main difference between them is that: (a) they are bonded by 1-6 and 1-4 glycosidic linkages respectively. (b) they differ in the α and  β configuration. (c) most of the fruits and grains are rich in starch and poor in cellulose or fiber. (d) starch is made of simple sugars while cellulose is made of amino sugars.

Answer»

(b) they differ in the α and  β configuration. 

17.

A biochemist prepared a mixture of all reactants and enzymes he thought were needed for DNA replication. When DNA was added, replication occurred. The product, however, consisted of the parent DNA strand paired with several DNA segments, each segment, a few hundred nucleotides long. Which of the following could possibly be missing in the reaction mixture?(a) DNA polymerase. (b) RNA primers. (c) DNA ligase. (d) Single strand binding proteins

Answer»

(c) DNA ligase.

18.

The number of classes of phenotypes in the F2 generation of a cross between dihybrids involving both the genes with incomplete dominance would be: (a) six (b) nine (c) sixteen (d) eight

Answer»

Correct answer is (b) nine

19.

 If blood of healthy human is tested after high protein meal, which of the following will not be observed? (a) Considerable increase in plasma glucose level. (b) Raised insulin level. (c) High plasma glucagon level. (d) Increased amino acids level.

Answer»

(c) High plasma glucagon level.

20.

Correct arrangement of the following in increasing size is : i. Width of biological membrane. ii. Diameter of E. coli DNA. iii. Human ribosome. iv. Length of E. coli DNA. v. Diameter of human liver cell. (a) i, iii, ii, iv, v (b) ii, i, iii, v, iv (c) i, iii, v, ii, iv (d) ii, iii, i, iv, v

Answer»

(b) ii, i, iii, v, iv

21.

The carbon atom (C) is one of the most important atoms in biological molecules. Several roperties of this "atom make it suitable for life on earth. Which of the following statements are true? I. Carbon-carbon bond energy is higher than the energy of visible spectrum of light. ii. Carbon-nitrogen bonds can be broken by UV light spontaneously. iii. Each hydrogen bond in water is stronger than the carbon-carbon covalent bond. iv. Carbon-hydrogen bond can be broken by infra red light spontaneously. (a) i & ii (b) i & iii (c) ii & iv (d) i, ii & iv

Answer»

Correct answer is (a) i & ii

22.

Four types of chemical messengers (Black Dots) released from the regulator cell (R) to the target cell (T) are depicted in I, II, III and IVMatch I, II, III and IV sequentially with (i) Steroid Hormone, (ii) Pheromones, (iii) Neurohormone iv) Neurotransmitter and choose the correct option. (a) iv, iii, ii, i (b) iv, iii, i, ii (c) i, ii, iii, iv (d) iii, iv, i, ii

Answer»

(b) iv, iii, i, ii

23.

If a gene needs to be introduced in a plant, the expression vector has to be: (a) pBR322 (b) Ti plasmid (c) λ phage (d) YAC

Answer»

(b) Ti plasmid

24.

Sclerides are the sclerenchyma cells with very thick secondary wall deposits and provide echanical support. In which of the following plant organs one would expect to find abundant sclerides? (a) Underground tuberous roots. (b) Leaves of floating hydrophyte. (c) Flower petals of mesophytes. (d) Petioles of xerophytic plant.

Answer»

(b) Leaves of floating hydrophyte.

25.

A littoral gastropod will have thickest shell when it is located at the (a) high tide marks on a rock beach. (b) greatest depth in a sand beach. (c) low tide marks on a mud beach. (d) bottom of a rock pool

Answer»

(a) high tide marks on a rock beach.

26.

In principle,longest Henle's loop should be found in the nephrons of desert dwelling mammal feeding mainly on : (a) succulent cactus (b) fleshy fruits (c) leathery leaves (d) seeds

Answer»

Correct answer is (d) seeds

27.

If a tissue is consuming 50 molecules of O2 and releasing 70 molecules of CO2, then the substrate being utilized in cellular respiration is : (a) glucose (b) fatty acid (c) amino acid (d) organic acid

Answer»

(d) organic acid

28.

Which of the following animals has blood as circulating medium? (a) Cockroach (b) Mussel (c) Leech (d) Planaria

Answer»

Correct answer is (b,c)

29.

Despite the lack of pressure, blood moves towards the heart in veins due to the (a) wider bore. (b) suction created due to pumping by heart. (c) narrow bores of efferent capillaries. (d) presence of valves preventing back flow.

Answer»

(b) suction created due to pumping by heart

30.

Following sequence of RNA, when translated will form a protein molecule of _____ amino acids.5' GCUCGCAUGCCAGAUGUCUUCGUCCUUUAGUUUAUUAGA 3' (a) 3 (b) 7 (c) 6 (d) 9

Answer»

Sequence of RNA, when translated will form a protein molecule of 7 amino acids.

31.

For various cellular processes, following molecules need to be transported from the site of synthesis to the site of activity. i. Nucleotides ii. tRNA iii. Histones iv. Deoxyribose sugar Which molecules from the above are transported from cytoplasm to nucleus? (a) i and ii (b) i and iii (c) ii and iv (d) i and iv

Answer»

Correct answer is (b) i and iii

32.

Three types of mutations are listed below: I. Chromosomal mutation II. Gene mutation iii. Somatic mutation Which of the following statements describe them correctly? (a) i & ii both describe the same phenomenon (b) iii will always result in abnormal cell growth leading to cancer. (c) Only gene mutation can alter the DNA sequence. (d) Gene duplication is a type of chromosomal mutation.

Answer»

(d) Gene duplication is a type of chromosomal mutation.

33.

Which of the diagrams given below will best represent stabilising selection In a population with continuous variations? X axis represents phenotype with quantitative variation while Y axis represents frequency of individuals,

Answer»

Correct answer is (c)

 X axis represents Original Population.

Y axis represents Evolved Population

34.

The X in the accompanying diagram is:(a) amniotic egg (b) bipedal locomotion (c) diapsid skull (d) four chambered heart

Answer»

(a) amniotic egg

35.

Which ofthe following is a mismatched pair? (a) Lady's finger - Capsule (b) Banana - Berry (c) Date - Drupe (d) Maize - Caryopsis

Answer»

(c) Date - Drupe 

36.

Which of the following assist in the locomotion of earthworm? i. Muscles in the body wall ii. Coelomic fluid iii. Septa iv. Setae (a) i, ii, iii and iv (b) Only i, ii and iv (c) Only ii, iii and iv (d) Only i and iv

Answer»

(b) Only i, ii and iv

37.

Which of the following processes requires energy? (a) Movement of calcium into a cell. (b) Secretion of mucus by a cell (c) Entry of oxygen into a cell. (d) Water absorption by a cell.

Answer»

(b) Secretion of mucus by a cell

38.

Eastern and Western Meadow Larks look almost the same and inhabit the same areas of Prairie. They recognize mates of their own species by distinctive courtship songs: This is an example of type of pre-zygotic isolation. (a) Ecological (b) gametic (c) mechanical (d) behavioural

Answer»

(d) behavioural

39.

The following pedigree traces the trait calIed achondroplasia, a form of dwarfism. Which of the following hypothesis can be supported by given pedigree?(a) The trait is due to dominant allele. (b) The trait is due to recessive allele. (c) The trait is sex linked. (d) Given information is not sufficient to hypothesize the situation.

Answer»

(a) The trait is due to dominant allele. 

40.

 A white footed mouse 'Peromyscus leucopus', a common rodent of South America can maintain core body temperature near 37ºC even if the air temperature is below 0ºC. This capacity gradually increases from birth to adulthood. Which graph correctly depicts ability of isolated individual animals to thermoregulate during their developmental stages? Note : Y axis depicts the temperature at which the animal can thermoregulate.

Answer»

Correct answer is (a)

41.

Tyloses are outgrowths of parenchyma cells growing into the adjoining xylem vessels clogging them progressively so that the sap wood gets transformed into heart wood. The most common reason for their formation is: (a) drought or lack of sap flowing through xylem. (b) accumulation of excessive storage material in cells of rays, (c) synthesis of alkaloid that modulate growth of parenchymal cells. (d) deprivation of nutrition to cells of rays.

Answer»

(a) drought or lack of sap flowing through xylem.

42.

Filtration rate through kidneys is dependent on the filtration pressure. This in turn depends on the following three factors: l. Glomerular blood hydrostatic pressure II. Capsular hydrostatic pressure III. Blood colloid osmotic pressure The net filtration pressure will be:(a) I+ II+ III (b) I - ( II + III) (c) (I+III)-II (d) II - (I + III)

Answer»

(b) I - ( II + III)

43.

Which of the following statements about plasmids is true? (a) Plasmids are genetically indispensable for host cells in the absence of a selection pressure. (b) Some plasmids have the ability to transfer themselves physically from one cell to another. (c) Plasmids are naked DNA molecules capable of survival outside a living cell'. (d) Plasmids do not depend on host enzymatic machinery for their replication.

Answer»

(b) Some plasmids have the ability to transfer themselves physically from one cell to another.

44.

Study the pedigree chart of a family showing the inheritance of a disorder and trace the trait.(a) Dominant X-linked (b) Recessive X-linked (c) Autosomal dominant (d) Autosomal recessive

Answer»

(b) Recessive X-linked 

45.

Find out the incorrect statement about action of hormones: (a) Steroid hormones are lipid soluble and pass across the cell membrane easily. (b) Synthesis of secondary messengers in the cell is activated by the binding of peptide hormones. (c) Receptor-steroid hormone complex binds to DNA causing transcription of genes. (d) Production of cAMP in the cell is activated by binding of steroid hormone to receptor.

Answer»

(d) Production of cAMP in the cell is activated by binding of steroid hormone to receptor.

46.

Three genes A, Band C are involved in determination of skin colour. If a couple with fair skin colour, produced a child with dark skin colour, then the genotype of the parents most probably can be: (a) Aabbcc x aaBbcc (b) AAbbcc x aabbcc (c) Aabbcc x aaBBcc (d) AaBbcc x aaBbCc

Answer»

(d) AaBbcc x aaBbCc

47.

Some R-plasmids carry genes for resistance to many antibiotics. This occurs naturally due to: (a) transposons (b) transduction (c) transformation (d) transgenesis

Answer»

(c) transformation

48.

Which of the following statements about human disorders caused by different organelles is true? (a) Peroxisomal disorders are due to mutations in nuclear genes. (b) Mitochondrial disorders are always due to mutations in maternally inherited mitochondrial genes. (c) Person can suffer from lysosomal storage diseases even if lysosomal hydrolases are synthesized in sufficient quantities. (d) Inefficient recycling of long chain fatty acids is likely to be a result of mitochondrial disorder.

Answer»

(b) Mitochondrial disorders are always due to mutations in maternally inherited mitochondrial genes. 

49.

Which of the following is a large single-celled organism?(a) Vorticella (b) Volvox (c) Acetabularia (d) Chlamydomonas

Answer»

(c) Acetabularia

50.

Some honey bee strains make a practice of removing the carcasses of dead larvae from their nests. This hygienic behaviour seems to be under the control of two recessive genes - uncapping the larval cells (U or u) and removing the carcass (R or r). Which of the following bees are non hygienic, but will remove dead pupae if cells are uncapped? (a) UuRr (b) uuRr (c) Uurr (d) uurr

Answer»

Correct answer is (c) Uurr

Previous Next