18288 + Interview Questions in Biology

1.	stability of \lbrack Ni(en)2\rbrack+2 is less than \lbrack Ni(dmg)2\rbrack. why
Answer» stability of \lbrack Ni(en)2\rbrack+2 is less than \lbrack Ni(dmg)2\rbrack. why

Discussion

2.	Hw do spermatozoa get nourished
Answer» Hw do spermatozoa get nourished

Discussion

3.	How to find number of moles?
Answer» How to find number of moles?

Discussion

4.	Conduction of impulses via saltatory mode in Myelinated neurons is _____ than Unmyelinated neurons .
Answer» Conduction of impulses via saltatory mode in Myelinated neurons is _____ than Unmyelinated neurons .

Discussion

5.	Which is not a example of areolar connective tissue? 1.perimycium 2.sub mucosa of stomach and oesophagus 3.Endoneurium 4.Endosteum
Answer» Which is not a example of areolar connective tissue? 1.perimycium 2.sub mucosa of stomach and oesophagus 3.Endoneurium 4.Endosteum

Discussion

6.	One turn of the citric acid cycle produces
Answer» One turn of the citric acid cycle produces

Discussion

7.	WHAT IS CD-4 RECEPTOR?
Answer» WHAT IS CD-4 RECEPTOR?

Discussion

8.	If the sequence of one strand of DNA is written as follows 5' - ATGCATGCATGCATGCATGCATGCATGC - 3' Write down the sequence of complementary strand in 5' → 3' direction.
Answer» If the sequence of one strand of DNA is written as follows 5' - ATGCATGCATGCATGCATGCATGCATGC - 3' Write down the sequence of complementary strand in 5' $\to$ 3' direction.

Discussion

9.	Which of the following does not hold true for the given image ?
Answer» Which of the following does not hold true for the given image ?

9.

Which of the following does not hold true for the given image ?

Answer»

Which of the following does not hold true for the given image ?

Discussion

10.	Where is work of protein synthesis takes place in cell?
Answer» Where is work of protein synthesis takes place in cell?

Discussion

11.	Match the figures with the respective descriptions
Answer» Match the figures with the respective descriptions

11.

Match the figures with the respective descriptions

Answer»

Match the figures with the respective descriptions

Discussion

12.	Eggplant and potato belong to the same genus Solanum, but to two different species. What defines them as separate species?
Answer» Eggplant and potato belong to the same genus Solanum, but to two different species. What defines them as separate species?

Discussion

13.	The process of guttation takes place
Answer» The process of guttation takes place

Discussion

14.	What is adherens?
Answer» What is adherens?

Discussion

15.	how cyclosporin act as immunosupressor drug
Answer» how cyclosporin act as immunosupressor drug

Discussion

16.	Explain the importance of 'selectable marker', with the help of a suitable example. [2 Marks]
Answer» Explain the importance of 'selectable marker', with the help of a suitable example. [2 Marks]

Discussion

17.	NEED THE SIMPLE EXPLAINATION OF PHOTOSYNTHESIS
Answer» NEED THE SIMPLE EXPLAINATION OF PHOTOSYNTHESIS

Discussion

18.	what is the difference between bone marrow produced lymphocyte and thymus lymphocyte?
Answer» what is the difference between bone marrow produced lymphocyte and thymus lymphocyte?

Discussion

19.	Molarity of a solutions relates the
Answer» Molarity of a solutions relates the

Discussion

20.	ये माने की चोटियाँ बूढ़ें लामाओं के जाप से उदास हो गई हैं- इस पंक्ति के माध्यम से लेखक ने युवा वर्ग से क्या आग्रह किया है?
Answer» ये माने की चोटियाँ बूढ़ें लामाओं के जाप से उदास हो गई हैं- इस पंक्ति के माध्यम से लेखक ने युवा वर्ग से क्या आग्रह किया है?

Discussion

21.	Question 43Fill in the blanks(a) Lining of blood vessels is made up of ___.(b) Lining of small intestine is made up of ___.(c) Lining of kidney tubules is made up of ___.(d) Epithelial cells with cilia are found in ___ of our body.
Answer» Question 43 Fill in the blanks (a) Lining of blood vessels is made up of ___. (b) Lining of small intestine is made up of ___. (c) Lining of kidney tubules is made up of ___. (d) Epithelial cells with cilia are found in ___ of our body.

Discussion

22.	Which of the following is not true about Echinoderms?
Answer» Which of the following is not true about Echinoderms?

Discussion

23.	AIDS spreads through
Answer» AIDS spreads through

Discussion

24.	What is a cation?
Answer» What is a cation?

Discussion

25.	Following is called ‘Cradle of speciation’.
Answer» Following is called ‘Cradle of speciation’.

Discussion

26.	Ground tissue includes
Answer» Ground tissue includes

Discussion

27.	Columns of Bertini are formed as extensions of
Answer» Columns of Bertini are formed as extensions of

Discussion

28.	If dominant C and P genes are essential for the development of purple colour in sweet pea flowers, what would be the ratio of white and purple colour in a cross between CcPp × CcPp.
Answer» If dominant C and P genes are essential for the development of purple colour in sweet pea flowers, what would be the ratio of white and purple colour in a cross between CcPp $\times$ CcPp.

Discussion

29.	How to find coordination no of compound like BaCl2
Answer» How to find coordination no of compound like BaCl2

Discussion

30.	Which of the following is the correct order for micturition to occur
Answer» Which of the following is the correct order for micturition to occur

Discussion

31.	The heart’s natural pacemaker is termed as the:
Answer» The heart’s natural pacemaker is termed as the:

Discussion

32.	Animals that have adapted themselves to live in deserts are known as
Answer» Animals that have adapted themselves to live in deserts are known as

Discussion

33.	Which among the following represents a homozygous condition?
Answer» Which among the following represents a homozygous condition?

Discussion

34.	Given below are a few statements related to external fertilization. Choose the correct statements. i The male and female gametes are formed and released simultaneously. ii Only a few gametes are released into the medium. iii water is the medium in a majority of organisms exhibiting external fertilization. iv Offspring formed as a result of external fertilization have better chance of survival than those formed inside an organism. (a) iii and iv (b) i and iii (c) ii and iv (d) i and iv.
Answer» Given below are a few statements related to external fertilization. Choose the correct statements. i The male and female gametes are formed and released simultaneously. ii Only a few gametes are released into the medium. iii water is the medium in a majority of organisms exhibiting external fertilization. iv Offspring formed as a result of external fertilization have better chance of survival than those formed inside an organism. (a) iii and iv (b) i and iii (c) ii and iv (d) i and iv.

Discussion

35.	Which of the following portions of a longerduplex DNA segment are likely to be recognition sequence of a restrictionenzyme?
Answer» Which of the following portions of a longer duplex DNA segment are likely to be recognition sequence of a restriction enzyme?

Discussion

36.	Which one of the following sets of animals share a four chambered heart? (a) Amphibian, Reptiles, Birds (b) Crocodiles, Birds, Mammals (c) Crocodiles, Lizards, Turtles (d) Lizards, Mammals, Birds
Answer» Which one of the following sets of animals share a four chambered heart? (a) Amphibian, Reptiles, Birds (b) Crocodiles, Birds, Mammals (c) Crocodiles, Lizards, Turtles (d) Lizards, Mammals, Birds

36.

Which one of the following sets of animals share a four chambered heart? (a) Amphibian, Reptiles, Birds (b) Crocodiles, Birds, Mammals (c) Crocodiles, Lizards, Turtles (d) Lizards, Mammals, Birds

Answer»

Which one of the following sets of animals share a four chambered heart?

(a) Amphibian, Reptiles, Birds

(b) Crocodiles, Birds, Mammals

(c) Crocodiles, Lizards, Turtles

(d) Lizards, Mammals, Birds

Discussion

37.	Zygotic meiosis is observed in
Answer» Zygotic meiosis is observed in

Discussion

38.	Human embryo is protected by________
Answer» Human embryo is protected by________

Discussion

39.	Tertiary wall is known from
Answer» Tertiary wall is known from

Discussion

40.	Paracetamol is/are:
Answer» Paracetamol is/are:

Discussion

41.	What is utilisation of chirality of molecules
Answer» What is utilisation of chirality of molecules

Discussion

42.	Give example(s) of: (a) Hyperglycemic hormone and hypoglycemic hormone (b) Hypercalcemic hormone (c) Gonadotrophic hormones (d) Progestational hormone (e) Blood pressure lowering hormone (f) Androgens and estrogens
Answer» Give example(s) of: (a) Hyperglycemic hormone and hypoglycemic hormone (b) Hypercalcemic hormone (c) Gonadotrophic hormones (d) Progestational hormone (e) Blood pressure lowering hormone (f) Androgens and estrogens

42.

Give example(s) of: (a) Hyperglycemic hormone and hypoglycemic hormone (b) Hypercalcemic hormone (c) Gonadotrophic hormones (d) Progestational hormone (e) Blood pressure lowering hormone (f) Androgens and estrogens

Answer»

Give
example(s) of:

(a)
Hyperglycemic hormone and hypoglycemic hormone

(b)
Hypercalcemic hormone

(c)
Gonadotrophic hormones

(d)
Progestational hormone

(e)
Blood pressure lowering hormone

(f) Androgens and estrogens

Discussion

43.	What is the life span of parrot and fruit fly?
Answer» What is the life span of parrot and fruit fly?

Discussion

44.	Which process produces alcohol or lactate?
Answer» Which process produces alcohol or lactate?

Discussion

45.	A post-reproductive cell remains in phase :
Answer» A post-reproductive cell remains in phase :

Discussion

46.	ntIntegrate the following with respect to xn nt1/(1-sinx)n
Answer» ntIntegrate the following with respect to xn nt1/(1-sinx)n

Discussion

47.	A species whose population size has reduced considerably and is at the verge of extinction is called
Answer» A species whose population size has reduced considerably and is at the verge of extinction is called

Discussion

48.	Which of the following species interactions have negative influence on all the organisms involved?
Answer» Which of the following species interactions have negative influence on all the organisms involved?

Discussion

49.	Match the animals given in column A with their site of extinction in column B: Column-A Column-B (i) Dodo (a) Africa (ii) Quagga (b) Russia (iii) Thylacine (c) Mauritius (iv) Stellar’s sea cow (d) Australia
Answer» Match the animals given in column A with their site of extinction in column B: Column-A Column-B (i) Dodo (a) Africa (ii) Quagga (b) Russia (iii) Thylacine (c) Mauritius (iv) Stellar’s sea cow (d) Australia

49.

Match the animals given in column A with their site of extinction in column B: Column-A Column-B (i) Dodo (a) Africa (ii) Quagga (b) Russia (iii) Thylacine (c) Mauritius (iv) Stellar’s sea cow (d) Australia

Answer»

Match the animals given in column A with their site of extinction in column B:

Column-A Column-B
(i) Dodo (a) Africa
(ii) Quagga (b) Russia
(iii) Thylacine (c) Mauritius
(iv) Stellar’s sea cow (d) Australia

Discussion

50.	The process in which nutrient enriched water bodies support a dense plant population,which kills animal life by depriving it of oxygen is called as:
Answer» The process in which nutrient enriched water bodies support a dense plant population,which kills animal life by depriving it of oxygen is called as:

Discussion

Explore topic-wise InterviewSolutions in Current Affairs.

stability of \lbrack Ni(en)2\rbrack+2 is less than \lbrack Ni(dmg)2\rbrack. why

Hw do spermatozoa get nourished

How to find number of moles?

Conduction of impulses via saltatory mode in Myelinated neurons is _____ than Unmyelinated neurons .

Which is not a example of areolar connective tissue? 1.perimycium 2.sub mucosa of stomach and oesophagus 3.Endoneurium 4.Endosteum

One turn of the citric acid cycle produces

WHAT IS CD-4 RECEPTOR?

If the sequence of one strand of DNA is written as follows 5' - ATGCATGCATGCATGCATGCATGCATGC - 3' Write down the sequence of complementary strand in 5' → 3' direction.

Which of the following does not hold true for the given image ?

Where is work of protein synthesis takes place in cell?

Match the figures with the respective descriptions

Eggplant and potato belong to the same genus Solanum, but to two different species. What defines them as separate species?

The process of guttation takes place

What is adherens?

how cyclosporin act as immunosupressor drug

Explain the importance of 'selectable marker', with the help of a suitable example. [2 Marks]

NEED THE SIMPLE EXPLAINATION OF PHOTOSYNTHESIS

what is the difference between bone marrow produced lymphocyte and thymus lymphocyte?

Molarity of a solutions relates the

Question 43Fill in the blanks(a) Lining of blood vessels is made up of ___.(b) Lining of small intestine is made up of ___.(c) Lining of kidney tubules is made up of ___.(d) Epithelial cells with cilia are found in ___ of our body.

Which of the following is not true about Echinoderms?

AIDS spreads through

What is a cation?

Following is called ‘Cradle of speciation’.

Ground tissue includes

Columns of Bertini are formed as extensions of

If dominant C and P genes are essential for the development of purple colour in sweet pea flowers, what would be the ratio of white and purple colour in a cross between CcPp × CcPp.

How to find coordination no of compound like BaCl2

Which of the following is the correct order for micturition to occur

The heart’s natural pacemaker is termed as the:

Animals that have adapted themselves to live in deserts are known as

Which among the following represents a homozygous condition?

Which of the following portions of a longerduplex DNA segment are likely to be recognition sequence of a restrictionenzyme?

Which one of the following sets of animals share a four chambered heart? (a) Amphibian, Reptiles, Birds (b) Crocodiles, Birds, Mammals (c) Crocodiles, Lizards, Turtles (d) Lizards, Mammals, Birds

Zygotic meiosis is observed in

Human embryo is protected by________

Tertiary wall is known from

Paracetamol is/are:

What is utilisation of chirality of molecules

Give example(s) of: (a) Hyperglycemic hormone and hypoglycemic hormone (b) Hypercalcemic hormone (c) Gonadotrophic hormones (d) Progestational hormone (e) Blood pressure lowering hormone (f) Androgens and estrogens

What is the life span of parrot and fruit fly?

Which process produces alcohol or lactate?

A post-reproductive cell remains in phase :

ntIntegrate the following with respect to xn nt1/(1-sinx)n

A species whose population size has reduced considerably and is at the verge of extinction is called

Which of the following species interactions have negative influence on all the organisms involved?

Match the animals given in column A with their site of extinction in column B: Column-A Column-B (i) Dodo (a) Africa (ii) Quagga (b) Russia (iii) Thylacine (c) Mauritius (iv) Stellar’s sea cow (d) Australia

The process in which nutrient enriched water bodies support a dense plant population,which kills animal life by depriving it of oxygen is called as:

Question 43Fill in the blanks(a) Lining of blood vessels is made up of _.(b) Lining of small intestine is made up of _.(c) Lining of kidney tubules is made up of _.(d) Epithelial cells with cilia are found in _ of our body.