If the sequence of one strand of DNA is written as follows 5' - ATGCA – InterviewSolution

1.	If the sequence of one strand of DNA is written as follows 5' - ATGCATGCATGCATGCATGCATGCATGC - 3' Write down the sequence of complementary strand in 5' → 3' direction.
Answer» If the sequence of one strand of DNA is written as follows 5' - ATGCATGCATGCATGCATGCATGCATGC - 3' Write down the sequence of complementary strand in 5' $\to$ 3' direction.

Discussion

No Comment Found

Related InterviewSolutions

Identify the incorrect option 1. Ovolution generally does not takes place during the lactational phase 2. Rhythm method of is a natural method to avoid unwanted pregnancy 3. Amniocentesis and ultrasonography are postanal Diagnostic techniques. 4. French drugs RU- 486, blocks the action of progesterone
235:66::531:21::328:103::711:?
Identify the phenomenon depicted in the given image.
what is the meaning og kreb cycle ?
Which of the following is absent in closed vascular bundles?
The taxonomic status of an organism can be changed by changing A) Anatomy B) Morphology C) Physiology D) Genetic makeup
Loose connective tissue that serves as a support framework of epithelium is:
What does parenchyma cells do.
On what basis are human blood groups decided? How many blood groups are there in humans?
Plants are classified into herbs, shrubs and trees based on their