18288 + Interview Questions in Biology

1.	The site of production of new RBCs in the case of adult human being is
Answer» The site of production of new RBCs in the case of adult human being is

Discussion

2.	Sieve tubes are characterised by:
Answer» Sieve tubes are characterised by:

Discussion

3.	Why do we need capacitors?
Answer» Why do we need capacitors?

Discussion

4.	When we say proteins have primary, secondary, tertiary and quaternary structures, are we referring to the protein? i.e does a single protein show all these structures? Or is it that some proteins exhibit primary structures while somesecondary….and so on?
Answer» When we say proteins have primary, secondary, tertiary and quaternary structures, are we referring to the protein? i.e does a single protein show all these structures? Or is it that some proteins exhibit primary structures while somesecondary….and so on?

Discussion

5.	Which of the following are pyrimidine bases?
Answer» Which of the following are pyrimidine bases?

Discussion

6.	Why are the classification systems changing every now and then?
Answer» Why are the classification systems changing every now and then?

Discussion

7.	YyRR is crossed with yyRR. The F1 progeny will be ___.
Answer» YyRR is crossed with yyRR. The $F_{1}$ progeny will be ___.

Discussion

8.	Arrange the following organisms in a correct sequence based on their formation during the course of evolution (A) Chemoautotrophic organisms (B) Eukaryotes (C) Anaerobic heterotrophs (D) Oxygenic autotrophic organisms
Answer» Arrange the following organisms in a correct sequence based on their formation during the course of evolution (A) Chemoautotrophic organisms (B) Eukaryotes (C) Anaerobic heterotrophs (D) Oxygenic autotrophic organisms

Discussion

9.	Question 17 Cyanobacteria and some other photosynthetic bacteria don't have chloroplasts. How do they conduct photosynthesis?
Answer» Question 17 Cyanobacteria and some other photosynthetic bacteria don't have chloroplasts. How do they conduct photosynthesis?

Discussion

10.	Name the technique which was used in producing 'Dolly' the sheep.
Answer» Name the technique which was used in producing 'Dolly' the sheep.

Discussion

11.	What is Dicer? What is its action? What is RISC (RNA induced silencing complex)?
Answer» What is Dicer? What is its action? What is RISC (RNA induced silencing complex)?

Discussion

12.	One character common in all pteridophytes is:
Answer» One character common in all pteridophytes is:

Discussion

13.	A liquid X of colour Y circulates in the human body only in one direction : from body tissues to the heart. Among other things, liquid X contains germs from cells and dead cells. The liquid X is cleaned of germs and dead cells by a special type of white blood cells called Z. This cleaned liquid is then put into blood circulatory system in subclavian veins. (a) What is (i) liquid X, and (ii) colour Y ? (b) What are Z ? (c) The liquid X is somewhat similar to a component of blood. Name this component. (d) Why is liquid X not red ?
Answer» A liquid X of colour Y circulates in the human body only in one direction : from body tissues to the heart. Among other things, liquid X contains germs from cells and dead cells. The liquid X is cleaned of germs and dead cells by a special type of white blood cells called Z. This cleaned liquid is then put into blood circulatory system in subclavian veins. (a) What is (i) liquid X, and (ii) colour Y ? (b) What are Z ? (c) The liquid X is somewhat similar to a component of blood. Name this component. (d) Why is liquid X not red ?

Discussion

14.	The giant redwood tree is:
Answer» The giant redwood tree is:

Discussion

15.	To get carpet-like grass lawns are mowed regularly. Is there any scientific explanation for this?
Answer» To get carpet-like grass lawns are mowed regularly. Is there any scientific explanation for this?

Discussion

16.	Describe the origin and evolution of humans in a chronological order. [3]
Answer» Describe the origin and evolution of humans in a chronological order. [3]

Discussion

17.	Match the following: (a) Operculum(i) Ctenophora(b) Parapodia(ii) Mollusca(c) Scales(iii) Porifera(d) Comb plates(iv) Reptilia(e)Radula(v) Annelida(f)Hairs(vi) Cyclostomata and Chondrichthyes(g) Choanocytes(vii) Mammalia(h) Gill slits(viii)Osteichthyes
Answer» Match the following: $\begin{matrix} (a) O p e r c u l u m & (i) C t e n o p h o r a (b) P a r a p o d i a & (i i) M o l l u s c a (c) S c a l e s & (i i i) P o r i f e r a (d) C o m b p l a t e s & (i v) R e p t i l i a (e) R a d u l a & (v) A n n e l i d a (f) H a i r s & (v i) C y c l o s t o m a t a a n d C h o n d r i c h t h y e s (g) C h o a n o c y t e s & (v i i) M a m m a l i a (h) G i l l s l i t s & (v i i i) O s t e i c h t h y e s \end{matrix}$

Discussion

18.	Which of the following results due to malfunctioning of the Leydig cells?
Answer» Which of the following results due to malfunctioning of the Leydig cells?

Discussion

19.	Consider the following statements. Which of the following above statements is/are incorrect?
Answer» Consider the following statements. Which of the following above statements is/are incorrect?

19.

Consider the following statements. Which of the following above statements is/are incorrect?

Answer»

Consider the following statements.

Which of the following above statements is/are incorrect?

Discussion

20.	Ozone hole causes Code:
Answer» Ozone hole causes Code:

20.

Ozone hole causes Code:

Answer»

Ozone hole causes

Code:

Discussion

21.	If the sequence of coding strand in transcription is as follows: 5’- ATGCATGCATGCATGCATGCATGCATGC - 3’ Write down the sequence of mRNA. [2]
Answer» If the sequence of coding strand in transcription is as follows: 5’- ATGCATGCATGCATGCATGCATGCATGC - 3’ Write down the sequence of mRNA. [2]

21.

If the sequence of coding strand in transcription is as follows: 5’- ATGCATGCATGCATGCATGCATGCATGC - 3’ Write down the sequence of mRNA. [2]

Answer»

If the sequence of coding strand in transcription is as follows:
5’- ATGCATGCATGCATGCATGCATGCATGC - 3’

Write down the sequence of mRNA. [2]

Discussion

22.	Which one of the following groups of plants do not show clear cut demarcation between three phases of life cycle?
Answer» Which one of the following groups of plants do not show clear cut demarcation between three phases of life cycle?

Discussion

23.	Meiosis involves:
Answer» Meiosis involves:

Discussion

24.	As we go from species to kingdom in a taxonomic hierarchy, the number of common characteristics (a) will decrease (b) will increase (c) remain same (d) may increase or decrease
Answer» As we go from species to kingdom in a taxonomic hierarchy, the number of common characteristics (a) will decrease (b) will increase (c) remain same (d) may increase or decrease

24.

As we go from species to kingdom in a taxonomic hierarchy, the number of common characteristics (a) will decrease (b) will increase (c) remain same (d) may increase or decrease

Answer»

As we go from species to kingdom in a taxonomic hierarchy, the number of common characteristics

(a) will decrease

(b) will increase

(c) remain same

(d) may increase or decrease

Discussion

25.	Using a Punnett square, work out the distribution of phenotypic features in the first filial (F1) generation after a cross between a homozygous female and a heterozygous male for a single locus.
Answer» Using a Punnett square, work out the distribution of phenotypic features in the first filial (F1) generation after a cross between a homozygous female and a heterozygous male for a single locus.

Discussion

26.	4 Name the vascular connection that exists between the digestive tract and liver.
Answer» 4 Name the vascular connection that exists between the digestive tract and liver.

Discussion

27.	What is the mechanism by which the AIDS virus causes deficiency of immune system of the infected person ?
Answer» What is the mechanism by which the AIDS virus causes deficiency of immune system of the infected person ?

Discussion

28.	How does the transmission of each of the following diseases take place ? (a) Amoebiasis (b) Malaria (c) Ascariasis (d) Pneumonia
Answer» How does the transmission of each of the following diseases take place ? (a) Amoebiasis (b) Malaria (c) Ascariasis (d) Pneumonia

28.

How does the transmission of each of the following diseases take place ? (a) Amoebiasis (b) Malaria (c) Ascariasis (d) Pneumonia

Answer»

How does the transmission of each of the following diseases take place ?

(a) Amoebiasis

(b) Malaria

(c) Ascariasis

(d) Pneumonia

Discussion

29.	1.7 m double helical DNA will have how many base pairs?
Answer» 1.7 m double helical DNA will have how many base pairs?

Discussion

30.	Which of these is a structural carbohydrate?
Answer» Which of these is a structural carbohydrate?

Discussion

31.	The vlosure of lid of pitcher plant is: a)A paratonic movement b)A tropic movement c)A turgor movement d)An autonomous movement
Answer» The vlosure of lid of pitcher plant is: a)A paratonic movement b)A tropic movement c)A turgor movement d)An autonomous movement

Discussion

32.	As we go from species to kingdom in the hierarchy classification how is the common characters increasing? This was the answer given for one of the practice question asked
Answer» As we go from species to kingdom in the hierarchy classification how is the common characters increasing? This was the answer given for one of the practice question asked

Discussion

33.	RNA contains the following sugar
Answer» RNA contains the following sugar

Discussion

34.	Match the following with respect to Hybridisation List−IList−IIA) Selfing in ParentI) To select the desirable hybridsB) EmasculationII) To avoid self pollinationC) BaggingIII) To develop homozygosityD) Selfing in F1 plantsIV) Artificial cross pollinationV) To avoid unwanted cross pollination
Answer» Match the following with respect to Hybridisation $\begin{matrix} L i s t - I & L i s t - I I A) S e l f i n g i n P a r e n t & I) T o s e l e c t t h e d e s i r a b l e h y b r i d s B) E m a s c u l a t i o n & I I) T o a v o i d s e l f p o l l i n a t i o n C) B a g g i n g & I I I) T o d e v e l o p h o m o z y g o s i t y D) S e l f i n g i n F 1 p l a n t s & I V) A r t i f i c i a l c r o s s p o l l i n a t i o n V) T o a v o i d u n w a n t e d c r o s s p o l l i n a t i o n \end{matrix}$

Discussion

35.	Do the plants that absorb contaminants such as heavy metals(phytoremediation) lead to biomagnification?
Answer» Do the plants that absorb contaminants such as heavy metals(phytoremediation) lead to biomagnification?

Discussion

36.	The cavity seen in the region of diencepalon is --------------. options: ventricle1, ventricle2, ventricle3, ventricle4.
Answer» The cavity seen in the region of diencepalon is --------------. options: ventricle1, ventricle2, ventricle3, ventricle4.

Discussion

37.	Differentiate between homology and analogy. Give one example of each. [3]
Answer» Differentiate between homology and analogy. Give one example of each. [3]

Discussion

38.	Which of the following is a defining characteristic of living organisms
Answer» Which of the following is a defining characteristic of living organisms

Discussion

39.	Mosses have a characteristic feature for reproduction called_____
Answer» Mosses have a characteristic feature for reproduction called_____

Discussion

40.	Pollenkitt is formed from
Answer» Pollenkitt is formed from

Discussion

41.	What is the difference between collenchyma and sclerenchyma?
Answer» What is the difference between collenchyma and sclerenchyma?

Discussion

42.	S.R. Kashyap is famous for:
Answer» S.R. Kashyap is famous for:

Discussion

43.	Ability of a plant to produce different kinds of structures is called __.
Answer» Ability of a plant to produce different kinds of structures is called __.

Discussion

44.	Flowers of Kigelia are pollinated by
Answer» Flowers of Kigelia are pollinated by

Discussion

45.	The term organoid is used for
Answer» The term organoid is used for

Discussion

46.	A plant shows the following symptoms: stunted growth, chlorosis and smaller leaves. This may be due to the deficiency of a micronutrient, possibly:
Answer» A plant shows the following symptoms: stunted growth, chlorosis and smaller leaves. This may be due to the deficiency of a micronutrient, possibly:

Discussion

47.	A catalyst has no effect on
Answer» A catalyst has no effect on

Discussion

48.	Lactational amenorrhea is a kind of periodic abstinence in which chances of fertilization is prevented upto a maximum period after parturition is
Answer» Lactational amenorrhea is a kind of periodic abstinence in which chances of fertilization is prevented upto a maximum period after parturition is

Discussion

49.	Small particles projecting from the inner membrane and cristae of mitochondria are
Answer» Small particles projecting from the inner membrane and cristae of mitochondria are

Discussion

50.	The function of vessels of xylem is to
Answer» The function of vessels of xylem is to

Discussion

Explore topic-wise InterviewSolutions in Current Affairs.

The site of production of new RBCs in the case of adult human being is

Sieve tubes are characterised by:

Why do we need capacitors?

When we say proteins have primary, secondary, tertiary and quaternary structures, are we referring to the protein? i.e does a single protein show all these structures? Or is it that some proteins exhibit primary structures while somesecondary….and so on?

Which of the following are pyrimidine bases?

Why are the classification systems changing every now and then?

YyRR is crossed with yyRR. The F1 progeny will be ___.

Arrange the following organisms in a correct sequence based on their formation during the course of evolution (A) Chemoautotrophic organisms (B) Eukaryotes (C) Anaerobic heterotrophs (D) Oxygenic autotrophic organisms

Question 17 Cyanobacteria and some other photosynthetic bacteria don't have chloroplasts. How do they conduct photosynthesis?

Name the technique which was used in producing 'Dolly' the sheep.

What is Dicer? What is its action? What is RISC (RNA induced silencing complex)?

One character common in all pteridophytes is:

The giant redwood tree is:

To get carpet-like grass lawns are mowed regularly. Is there any scientific explanation for this?

Describe the origin and evolution of humans in a chronological order. [3]

Match the following: (a) Operculum(i) Ctenophora(b) Parapodia(ii) Mollusca(c) Scales(iii) Porifera(d) Comb plates(iv) Reptilia(e)Radula(v) Annelida(f)Hairs(vi) Cyclostomata and Chondrichthyes(g) Choanocytes(vii) Mammalia(h) Gill slits(viii)Osteichthyes

Which of the following results due to malfunctioning of the Leydig cells?

Consider the following statements. Which of the following above statements is/are incorrect?

Ozone hole causes Code:

If the sequence of coding strand in transcription is as follows: 5’- ATGCATGCATGCATGCATGCATGCATGC - 3’ Write down the sequence of mRNA. [2]

Which one of the following groups of plants do not show clear cut demarcation between three phases of life cycle?

Meiosis involves:

As we go from species to kingdom in a taxonomic hierarchy, the number of common characteristics (a) will decrease (b) will increase (c) remain same (d) may increase or decrease

Using a Punnett square, work out the distribution of phenotypic features in the first filial (F1) generation after a cross between a homozygous female and a heterozygous male for a single locus.

4 Name the vascular connection that exists between the digestive tract and liver.

What is the mechanism by which the AIDS virus causes deficiency of immune system of the infected person ?

How does the transmission of each of the following diseases take place ? (a) Amoebiasis (b) Malaria (c) Ascariasis (d) Pneumonia

1.7 m double helical DNA will have how many base pairs?

Which of these is a structural carbohydrate?

The vlosure of lid of pitcher plant is: a)A paratonic movement b)A tropic movement c)A turgor movement d)An autonomous movement

As we go from species to kingdom in the hierarchy classification how is the common characters increasing? This was the answer given for one of the practice question asked

RNA contains the following sugar

Match the following with respect to Hybridisation List−IList−IIA) Selfing in ParentI) To select the desirable hybridsB) EmasculationII) To avoid self pollinationC) BaggingIII) To develop homozygosityD) Selfing in F1 plantsIV) Artificial cross pollinationV) To avoid unwanted cross pollination

Do the plants that absorb contaminants such as heavy metals(phytoremediation) lead to biomagnification?

The cavity seen in the region of diencepalon is --------------. options: ventricle1, ventricle2, ventricle3, ventricle4.

Differentiate between homology and analogy. Give one example of each. [3]

Which of the following is a defining characteristic of living organisms

Mosses have a characteristic feature for reproduction called_____

Pollenkitt is formed from

What is the difference between collenchyma and sclerenchyma?

S.R. Kashyap is famous for:

Ability of a plant to produce different kinds of structures is called __.

Flowers of Kigelia are pollinated by

The term organoid is used for

A plant shows the following symptoms: stunted growth, chlorosis and smaller leaves. This may be due to the deficiency of a micronutrient, possibly:

A catalyst has no effect on

Lactational amenorrhea is a kind of periodic abstinence in which chances of fertilization is prevented upto a maximum period after parturition is

Small particles projecting from the inner membrane and cristae of mitochondria are

The function of vessels of xylem is to