If the sequence of coding strand in transcription is as follows: 5’-

1.	If the sequence of coding strand in transcription is as follows: 5’- ATGCATGCATGCATGCATGCATGCATGC - 3’ Write down the sequence of mRNA. [2]
Answer» If the sequence of coding strand in transcription is as follows: 5’- ATGCATGCATGCATGCATGCATGCATGC - 3’ Write down the sequence of mRNA. [2]

If the sequence of coding strand in transcription is as follows: 5’- ATGCATGCATGCATGCATGCATGCATGC - 3’ Write down the sequence of mRNA. [2]

Answer»

If the sequence of coding strand in transcription is as follows:
5’- ATGCATGCATGCATGCATGCATGCATGC - 3’

Write down the sequence of mRNA. [2]