This section includes 7 InterviewSolutions, each offering curated multiple-choice questions to sharpen your Current Affairs knowledge and support exam preparation. Choose a topic below to get started.
| 1. |
Chlamydomonas reproduces by |
|
Answer» Chlamydomonas reproduces by |
|
| 2. |
Why vincristine and vinblastin don not affect our normal body cells? |
| Answer» Why vincristine and vinblastin don not affect our normal body cells? | |
| 3. |
The enzyme required for transcription is: |
|
Answer» The enzyme required for transcription is: |
|
| 4. |
Identify the enzymes responsible for the following processes in the digestion of carbohydrates : |
|
Answer» Identify the enzymes responsible for the following processes in the digestion of carbohydrates : |
|
| 5. |
Why is the offspring formed by asexual reproduction referred to as clone? |
|
Answer» Why is the offspring formed by asexual reproduction referred to as clone? |
|
| 6. |
Where is the seminal vesicle in cockroach located with respect tothe mushroom gland ? |
| Answer» Where is the seminal vesicle in cockroach located with respect tothe mushroom gland ? | |
| 7. |
'Peat' is an important source of domestic fuel in several countries. How is 'peat' formed in nature? |
|
Answer» 'Peat' is an important source of domestic fuel in several countries. How is 'peat' formed in nature? |
|
| 8. |
Are there 8 proteins in the gap junctions between 2 epithelial cells? |
| Answer» Are there 8 proteins in the gap junctions between 2 epithelial cells? | |
| 9. |
The part of antibody molecule which acts asa binding site for specific related antigen is |
|
Answer» The part of antibody molecule which acts asa binding site for specific related antigen is |
|
| 10. |
Fresh milk has a pH of 6.When it changes into curd (yogurt), will its pH value increase or decrease? Why? [2 MARKS] |
|
Answer» Fresh milk has a pH of 6.When it changes into curd (yogurt), will its pH value increase or decrease? Why? [2 MARKS] |
|
| 11. |
An exception among chlorophyllous bryophytes is _________ |
|
Answer» An exception among chlorophyllous bryophytes is _________ |
|
| 12. |
What is surface antigens |
| Answer» What is surface antigens | |
| 13. |
Most fishes and amphibians |
|
Answer» Most fishes and amphibians |
|
| 14. |
If the town with a population of 500 individuals sees an increase by 80 individuals and has 20 individuals dying, what would be the growth rate of the population? |
|
Answer» If the town with a population of 500 individuals sees an increase by 80 individuals and has 20 individuals dying, what would be the growth rate of the population? |
|
| 15. |
In the given figure 10.2, mark the positions of the endocrine glands which release the hormones that:(a) controls the release of sex hormones.(b) is responsible for the secondary sexual characters in boys.(c) prevents diabetes.(d) maintains the correct salt balance in the blood. |
|
Answer» In the given figure 10.2, mark the positions of the endocrine glands which release the hormones that: |
|
| 16. |
Write about the different types of breeding of sheep and also comment about the origin of the respective breed? |
|
Answer» Write about the different types of breeding of sheep and also comment about the origin of the respective breed? |
|
| 17. |
The given figure represents the process of transcription in bacteria. |
|
Answer» The given figure represents the process of transcription in bacteria. |
|
| 18. |
Nucellar embryo is Amphimictic haploid Amphimictic diploid Apomictic haploid Apomictic diploid Explain..... |
|
Answer» Nucellar embryo is Amphimictic haploid Amphimictic diploid Apomictic haploid Apomictic diploid Explain..... |
|
| 19. |
In malignant tumors, the cells proliferate, grow rapidly and move to other parts of the body to form new tumors. This stage of disease is called |
|
Answer» In malignant tumors, the cells proliferate, grow rapidly and move to other parts of the body to form new tumors. This stage of disease is called |
|
| 20. |
Animals that reproduce by laying eggs are |
|
Answer» Animals that reproduce by laying eggs are |
|
| 21. |
Structure of double stranded DNA and single stranded DNA |
| Answer» Structure of double stranded DNA and single stranded DNA | |
| 22. |
Of the following taxonomic categories which is the most inclusive. A) order B) class C) genus D) family. |
|
Answer» Of the following taxonomic categories which is the most inclusive. A) order B) class C) genus D) family. |
|
| 23. |
What is ph of a substance? |
| Answer» What is ph of a substance? | |
| 24. |
In the above cross, what is the ratio between homozygous plants and heterozygous plants of F2 progeny? |
|
Answer» In the above cross, what is the ratio between homozygous plants and heterozygous plants of F2 progeny? |
|
| 25. |
ntHenrys law constant of co2 in water at 298k is 5/3bar.if pressure of co2is 0.01 bar,find its mole fraction?n |
| Answer» ntHenrys law constant of co2 in water at 298k is 5/3bar.if pressure of co2is 0.01 bar,find its mole fraction?n | |
| 26. |
The vectorless gene transfer include |
|
Answer» The vectorless gene transfer include |
|
| 27. |
Differentiate between the followings: (a) Repetitive DNA and Satellite DNA (b) mRNA and tRNA (c) Template strand and Coding strand |
|
Answer» Differentiate
(a)
(b)
(c)
|
|
| 28. |
Which of the following is the upper part of the womb? |
|
Answer» Which of the following is the upper part of the womb? |
|
| 29. |
what is the structure of haemoglobin? what is pneumotaxis centre(in respiratory system)? |
| Answer» what is the structure of haemoglobin? what is pneumotaxis centre(in respiratory system)? | |
| 30. |
why focal length of concave lens is negativ |
| Answer» why focal length of concave lens is negativ | |
| 31. |
The figure shows a diagrammatic view of the human respiratory system with labels. Select the option that gives the incorrect identification and main function or characteristic. |
|
Answer» The figure shows a diagrammatic view of the human respiratory system with labels. Select the option that gives the incorrect identification and main function or characteristic. |
|
| 32. |
How many mitotic and meiotic divisions are required to produce a seed starting from microspore Mother cell and megaspore mother cell |
| Answer» How many mitotic and meiotic divisions are required to produce a seed starting from microspore Mother cell and megaspore mother cell | |
| 33. |
F= 9-4x. Is it SHM or not. Give explanation. |
| Answer» F= 9-4x. Is it SHM or not. Give explanation. | |
| 34. |
define axo-dendritic,axo-somatic and axo-axonic |
| Answer» define axo-dendritic,axo-somatic and axo-axonic | |
| 35. |
Read the following paragraph and identify the disease.Today, her child became one and half year old. However, that child does not seem to be healthy and happy. It was continuously crying and gradually becoming weak. It has shortness of breath. Its nails have become blue. |
|
Answer» Read the following paragraph and identify the disease. Today, her child became one and half year old. However, that child does not seem to be healthy and happy. It was continuously crying and gradually becoming weak. It has shortness of breath. Its nails have become blue. |
|
| 36. |
What is insemination? |
|
Answer» What is insemination? |
|
| 37. |
Are the calcium, rubidium and cesium making their nitride? |
| Answer» Are the calcium, rubidium and cesium making their nitride? | |
| 38. |
Why should a highly variable external environment bother organisms after all? |
|
Answer» Why should a highly variable external environment bother organisms after all? |
|
| 39. |
If the sequence of the coding strand in a transcription unit is written as follows 5' - ATGCATGCATGCATGCATGCATGCATGC - 3' Write down the sequence of mRNA. |
|
Answer» If the sequence of the coding strand in a transcription unit is written as follows |
|
| 40. |
Assertion (A): Higher plants can not utilize nitrogen that is present in the form of N2 in air.Reason (R): In higher plants, the nitrogenase enzyme is absent. |
|
Answer» Assertion (A): Higher plants can not utilize nitrogen that is present in the form of N2 in air. Reason (R): In higher plants, the nitrogenase enzyme is absent. |
|
| 41. |
The lower surface of leaf will have more number of stomata in a: |
|
Answer» The lower surface of leaf will have more number of stomata in a: |
|
| 42. |
Triticale is a somatic hybrid formed between |
|
Answer» Triticale is a somatic hybrid formed between |
|
| 43. |
Fill in the blanks:(a) Humansreproduce __________. (asexually/sexually)(b) Humansare__________. (oviparous/viviparous/ovoviviparous)(c) Fertilizationis __________ in humans. (external/internal)(d) Male andfemale gametes are __________. (diploid/haploid)(e) Zygote is__________. (diploid/haploid)(f) The process of release of the ovum from a mature follicleis called__________.(g) Ovulationis induced by a hormone called the __________. (h) The fusionof the male and the female gametes is called __________.(i) Fertilizationtakes place in the __________.(j) The zygotedivides to form __________, which is implanted in uterus.(k) The structure which provides vascular connection betweenthe fetus and uterus is called __________. |
|
Answer» Fill in the blanks: (a) Humans (b) Humans (c) Fertilization (d) Male and (e) Zygote is
(g) Ovulation (h) The fusion (i) Fertilization (j) The zygote
|
|
| 44. |
What is Endomitosis? |
| Answer» What is Endomitosis? | |
| 45. |
Question 41 Write brief note on the following Synaptonemal complex Metaphase plate |
|
Answer» Question 41 Metaphase plate |
|
| 46. |
29.Explain the Posse-Germain's Identity |
| Answer» 29.Explain the Posse-Germain's Identity | |
| 47. |
Regarding the assertion and reason; choose the correct option. Assertion (A): In case of acute constipation, purgatives containing magnesium salts are usually used to alleviate it Reason (R): The osmotic effect of Mg2+ in the intestinal lumen prevents water from being reabsorbed from the intestine. Mg2+ increases the solute concentration in the intestinal lumen because Mg2+ is absorbed very slowly |
|
Answer» Regarding the assertion and reason; choose the correct option. Assertion (A): In case of acute constipation, purgatives containing magnesium salts are usually used to alleviate it Reason (R): The osmotic effect of Mg2+ in the intestinal lumen prevents water from being reabsorbed from the intestine. Mg2+ increases the solute concentration in the intestinal lumen because Mg2+ is absorbed very slowly |
|
| 48. |
Mention two objectives of setting up GEAC by our Government. [1] |
| Answer» Mention two objectives of setting up GEAC by our Government. [1] | |
| 49. |
The weight of a fruit is determined by three pairs if polygenes.following cross AABBCC (dark colour) , in F2 generation what proportion of the progeny is likely to resemble either parent? 1.none 2.less than 5 percent 3.one third 4.half |
| Answer» The weight of a fruit is determined by three pairs if polygenes.following cross AABBCC (dark colour) , in F2 generation what proportion of the progeny is likely to resemble either parent? 1.none 2.less than 5 percent 3.one third 4.half | |
| 50. |
Chassez l'intrus.1. jupe, cravate, manteau, chemise.2. fromage, confiture, beurre, pomme.3. poulet, jambon, haricot vert, viande.4. grand, jolie, méchant, amusant. |
|
Answer» Chassez l'intrus. 1. jupe, cravate, manteau, chemise. 2. fromage, confiture, beurre, pomme. 3. poulet, jambon, haricot vert, viande. 4. grand, jolie, méchant, amusant. |
|